RegulonDB RegulonDB 10.10: Operon Form
   

lrp operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: lrp
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: lrp
Synonym(s): OP00251
Gene(s): lrp   Genome Browser M3D Gene expression COLOMBOS
Note(s): It is not yet clear whether there are other genes dowstream of lrp that are transcribed from the lrpp promoter. ftsK is a gene regulated by LexA, and the ts gene immediately dowstream of lrp is transcribed in the same direction. It is likely that ftsK has a separate promoter, because the expression of ftsK is markedly increased after treatment of E. coli with mitomycin. BglG has a regulatory role in lrp expression through two independent mechanisms, one being the gcvA-gcvB pathway and the other through GadE during stationary phase. BglB also has a physiological role in elimination of toxic metabolites generated by the catabolism of serine-containing peptides; these peptides are the result of elevated levels of uptake Shukla S,2019
Reference(s): [1] Wang Q., et al., 1994
Promoter
Name: lrpp
+1: 932328
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 267
Sequence: ttgtactaaaaatcgatgttttgctttgacaatcccctggtgttttgcgaaaacattcgaGgaagaaaaaaaacagtattc
                          -35                    -10        +1                   
Evidence: [ICWHO]
[TIM]
Reference(s): [2] Huerta AM., et al., 2003
[1] Wang Q., et al., 1994
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadE activator lrpp nd nd nd nd nd [GEA], [BPP] [10]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor lrpp nd nd nd nd nd [GEA], [BPP] [11]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Lrp repressor lrpp 932265 932279 -56.0 aatatctggcATGTTGTACTAAAAAtcgatgtttt nd [BCE], [SM] [1]
proximal Lrp repressor lrpp 932328 932343 8.0 aaacattcgaGGAAGAAAAAAAACAGtattcttata nd [GEA], [AIBSCS] [6]
remote Lrp repressor lrpp 932351 932368 32.0 cagtattcttATATGCGCATAACCATGCatgtaaatac nd [GEA], [AIBSCS] [6]
remote Lrp repressor lrpp 932369 932383 49.0 ataaccatgcATGTAAATACCATGTttaccgtgct nd [APIORCISFBSCS], [SM] [1], [7], [8]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NsrR repressor lrpp 932374 932385 52.0 catgcatgtaAATACCATGTTTaccgtgctag nd [GEA], [APIORCISFBSCS] [9]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicF lrp repressor 932573 932606 GGAAUACAGAGAGACAAUAAUAAUGGUAGAUAGC TRANSLATION-BLOCKING [IEP], [SM] [3], [4]
small regulatory RNA GcvB lrp repressor 932556 932563 CAGACAGG nd [IEP], [IPI], [SM] [4], [5]
small regulatory RNA DsrA lrp repressor 932598 932615 GUAGAUAGCAAGAAGCGC nd [IEP], [SM] [4]
small regulatory RNA GcvB lrp repressor 932416 932420 GACAG nd [IEP], [IPI], [SM] [4]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp activation lrpp nd   [GEA] [12]
Evidence: [GEA] Gene expression analysis
Reference(s): [12] Landgraf JR., et al., 1996




Reference(s)    

 [1] Wang Q., Wu J., Friedberg D., Plakto J., Calvo JM., 1994, Regulation of the Escherichia coli lrp gene., J Bacteriol 176(7):1831-9

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Holmqvist E., Unoson C., Reimegard J., Wagner EG., 2012, A mixed double negative feedback loop between the sRNA MicF and the global regulator Lrp., Mol Microbiol 84(3):414-27

 [4] Lee HJ., Gottesman S., 2016, sRNA roles in regulating transcriptional regulators: Lrp and SoxS regulation by sRNAs., Nucleic Acids Res 44(14):6907-23

 [5] Modi SR., Camacho DM., Kohanski MA., Walker GC., Collins JJ., 2011, Functional characterization of bacterial sRNAs using a network biology approach., Proc Natl Acad Sci U S A 108(37):15522-7

 [6] Lintner RE., Mishra PK., Srivastava P., Martinez-Vaz BM., Khodursky AB., Blumenthal RM., 2008, Limited functional conservation of a global regulator among related bacterial genera: Lrp in Escherichia, Proteus and Vibrio., BMC Microbiol 8:60

 [7] Fraenkel YM., Mandel Y., Friedberg D., Margalit H., 1995, Identification of common motifs in unaligned DNA sequences: application to Escherichia coli Lrp regulon., Comput Appl Biosci 11(4):379-87

 [8] Lin R., D'Ari R., Newman EB., 1992, Lambda placMu insertions in genes of the leucine regulon: extension of the regulon to genes not regulated by leucine., J Bacteriol 174(6):1948-55

 [9] Partridge JD., Bodenmiller DM., Humphrys MS., Spiro S., 2009, NsrR targets in the Escherichia coli genome: new insights into DNA sequence requirements for binding and a role for NsrR in the regulation of motility., Mol Microbiol 73(4):680-94

 [10] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [11] Oshima T., Ito K., Kabayama H., Nakamura Y., 1995, Regulation of lrp gene expression by H-NS and Lrp proteins in Escherichia coli: dominant negative mutations in lrp., Mol Gen Genet 247(5):521-8

 [12] Landgraf JR., Wu J., Calvo JM., 1996, Effects of nutrition and growth rate on Lrp levels in Escherichia coli., J Bacteriol 178(23):6930-6


RegulonDB