RegulonDB RegulonDB 11.1: Operon Form
   

aer operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: aer
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: aer
Gene(s): aer   Genome Browser M3D Gene expression COLOMBOS
Note(s): The trgp1 and aerp promoters are the only Escherichia coli σ28 promoters that are activated by CRP Hollands K,2010
J. Oberto in 2010 identified a possible binding site for NagC, GTTAATTATCTTGCCCAAAAATC, in the intergenic region of the divergent genes aer and patA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Evidence: [COMP-AINF-SINGLE-DIRECTON] Automated inference that a single-gene directon is a transcription unit
Promoter
Name: aerp
+1: 3219120
Sigma Factor: Sigma28 Sigmulon
Distance from start of the gene: 44
Sequence: aattgcgatctaaatcaaattaatcggttaaagataaccgcagcggggccgacataaactCtgacaagaagttaacaacca
                                 -35                   -10  +1                   
Note(s): The conservation of the spacing between the DNA site for CRP and the -10 and -35 elements at the aer and trg promoters suggests that the mechanisms of transcription activation at the two promoters are similar Hollands K,2010
Evidence: [COMP-AINF]
[COMP-HINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[COMP-HINF-SIMILAR-TO-CONSENSUS]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IMP]
Reference(s): [1] Chilcott GS., et al., 2000
[2] Hollands K., et al., 2010
[3] Huerta AM., et al., 2003
[4] Park K., et al., 2001
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator aerp 3219159 3219180 -49.5 ttaaatcgcaAATTGCGATCTAAATCAAATTAatcggttaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [5]
[FNR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR activator aerp 3219163 3219176 -49.5 atcgcaaattGCGATCTAAATCAAattaatcggt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [6]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF] Inferred by a human based on computational evidence

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IMP] Inferred from mutant phenotype

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Chilcott GS., Hughes KT., 2000, Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar typhimurium and Escherichia coli., Microbiol Mol Biol Rev 64(4):694-708

 [2] Hollands K., Lee DJ., Lloyd GS., Busby SJ., 2010, Activation of sigma 28-dependent transcription in Escherichia coli by the cyclic AMP receptor protein requires an unusual promoter organization., Mol Microbiol 75(5):1098-111

 [3] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [4] Park K., Choi S., Ko M., Park C., 2001, Novel sigmaF-dependent genes of Escherichia coli found using a specified promoter consensus., FEMS Microbiol Lett 202(2):243-50

 [5] Hollands K., Busby SJ., Lloyd GS., 2007, New targets for the cyclic AMP receptor protein in the Escherichia coli K-12 genome., FEMS Microbiol Lett 274(1):89-94

 [6] Constantinidou C., Hobman JL., Griffiths L., Patel MD., Penn CW., Cole JA., Overton TW., 2006, A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth., J Biol Chem 281(8):4802-15

RegulonDB