RegulonDB RegulonDB 11.2: Operon Form
   

iscRSUA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: iscRSUA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: iscRSUA
Gene(s): iscA, iscU, iscS, iscR   Genome Browser M3D Gene expression COLOMBOS
Note(s): Expression of the iscRSUA operon is induced by hydrogen peroxide and paraquat Zheng M,2001.
An iscS mutant affects the expression of udp (UPase), cdd (CDA), and yeiT-yeiA (DPD). Based on the study mentioned above, Mihara et al. (2008) postulated that an unknown factor, depending on the Fe-S cluster, controls either directly or indirectly the expression of these genes Mihara H,2008
The iscS gene plays an important role in the expression of pyrimidine metabolism genes and provides proof of the potential relationship between iscS and global gene regulation Mihara H,2008
Under either anaerobic or aerobic growth conditions, IscR represses transcription of the operon iscRSUA, which encodes genes for the Fe-S cluster biogenesis pathways. The repression of the isc operon by IscR responds to the demand for the Fe-S cluster in the medium, because IscR has to be bound to an Fe-S group to be able to repress the transcription of the isc operon Giel JL,2013 Under anaerobiosis, the demand for the Fe-S group is lower than under aerobiosis, and therefore the repression of the operon is stronger than under aerobiosis Giel JL,2013 The accumulation of the protein IscR is enhanced during iron-limiting conditions, while the other proteins encoded in the iscRSUA operon are diminished; these findings are in agreement with the fact that IscR is a repressor of the operon Zupok A,2019.
IscR recognizes and binds two DNA-binding sites that overlap the promoter sequence to repress transcription of the iscRSUA operon. Therefore, it appears that when the protein is bound to these sites, the RNA polymerase is not able to bind to the promoter region to start transcription Giel JL,2013 Although the two sites are required for complete repression of the operon, the binding of IclR to one of them does not depend on the presence of the other Giel JL,2013
IscR regulates in a coordinated manner the expression of the iscRSUA to the sufABCDSE operons through repression by [2Fe-2S]-IscR and activation by apo-IscR, respectively. Both the apo- and holoprotein conformations were able to activate the Suf pathway in order to maintain differential control for Fe-S cluster biogenesis pathways to ensure viability under a variety of growth conditions Mettert EL,2014
Evidence: [EXP-IEP] Inferred from expression pattern
[EXP-IEP-COREGULATION] Inferred through co-regulation
[EXP-IMP-POLAR-MUTATION] Polar mutation
Reference(s): [1] Schwartz CJ., et al., 2001
[2] Takahashi Y., et al., 1999
Promoter
Name: iscRp
+1: 2662199
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 68
Sequence: cgactaaatcagtcaagtaaatagttgaccaatttactcgggaatgtcagacttgaccctGctatgcaatacccccacttt
                              -35                    -10    +1                   
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [3] Huerta AM., et al., 2003
[1] Schwartz CJ., et al., 2001
[4] Zheng M., et al., 2001
TF binding sites (TFBSs)
[IscR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IscR-a [2Fe-2S] iron-sulfur cluster repressor iscRp 2662215 2662239 -28.0 agtcaagtaaATAGTTGACCAATTTACTCGGGAATgtcagacttg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [1], [7], [8], [9]
proximal IscR-a [2Fe-2S] iron-sulfur cluster repressor iscRp 2662240 2662264 -53.0 tgaaggttaaATACCCGACTAAATCAGTCAAGTAAatagttgacc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [7], [8], [9]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB iscRSUA repressor 2661532 2661557 UGCUCUAUAAACUCCGUACAUCACUC TRANSLATION-BLOCKING, MRNA-DEGRADATION [EXP-IEP], [EXP-IMP-SITE-MUTATION], [EXP-IPI] [5], [6]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP-SITE-MUTATION] Site mutation

 [EXP-IEP] Inferred from expression pattern

 [EXP-IPI] Inferred from physical interaction


Reference(s)    

 [1] Schwartz CJ., Giel JL., Patschkowski T., Luther C., Ruzicka FJ., Beinert H., Kiley PJ., 2001, IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins., Proc Natl Acad Sci U S A 98(26):14895-900

 [2] Takahashi Y., Nakamura M., 1999, Functional assignment of the ORF2-iscS-iscU-iscA-hscB-hscA-fdx-ORF3 gene cluster involved in the assembly of Fe-S clusters in Escherichia coli., J Biochem 126(5):917-26

 [3] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [4] Zheng M., Wang X., Templeton LJ., Smulski DR., LaRossa RA., Storz G., 2001, DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide., J Bacteriol 183(15):4562-70

 [5] Desnoyers G., Morissette A., Prevost K., Masse E., 2009, Small RNA-induced differential degradation of the polycistronic mRNA iscRSUA., EMBO J 28(11):1551-61

 [6] Prevost K., Desnoyers G., Jacques JF., Lavoie F., Masse E., 2011, Small RNA-induced mRNA degradation achieved through both translation block and activated cleavage., Genes Dev 25(4):385-96

 [7] Giel JL., Nesbit AD., Mettert EL., Fleischhacker AS., Wanta BT., Kiley PJ., 2013, Regulation of iron-sulphur cluster homeostasis through transcriptional control of the Isc pathway by [2Fe-2S]-IscR in Escherichia coli., Mol Microbiol 87(3):478-92

 [8] Giel JL., Rodionov D., Liu M., Blattner FR., Kiley PJ., 2006, IscR-dependent gene expression links iron-sulphur cluster assembly to the control of O-regulated genes in Escherichia coli., Mol Microbiol 60(4):1058-75

 [9] Yeo WS., Lee JH., Lee KC., Roe JH., 2006, IscR acts as an activator in response to oxidative stress for the suf operon encoding Fe-S assembly proteins., Mol Microbiol 61(1):206-18

 [10] Wright PR., Richter AS., Papenfort K., Mann M., Vogel J., Hess WR., Backofen R., Georg J., 2013, Comparative genomics boosts target prediction for bacterial small RNAs., Proc Natl Acad Sci U S A 110(37):E3487-96

RegulonDB