RegulonDB RegulonDB 11.1: Operon Form
   

acnB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: acnB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: acnB
Gene(s): acnB   Genome Browser M3D Gene expression COLOMBOS
Note(s): The expression of acnB is enhanced during and after the switch from aerobic to anaerobic growth conditions Trotter EW, Rolfe MD, Hounslow AM, Craven CJ, Williamson MP, Sanguinetti G, Poole RK, Green J,2011
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for acnB . This structure could regulate the expression of the gene, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Cunningham L., et al., 1997
Promoter
Name: acnBp1
+1: 131519
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 96
Sequence: tttatgttgcttttttgtaaacagattaacacctcgtcaaaatcctgctattctgcccgtTgcggtactgggcatttaccc
                          -35                    -10        +1                   
Evidence: [COMP-AINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Cunningham L., et al., 1997
[2] Huerta AM., et al., 2003
[3] Mendoza-Vargas A., et al., 2009
Terminator(s)
Type: rho-independent
Sequence: acgacacaatGCCCGGTGAATGAGATTCCCGGGCatttttttat
Reference(s): [4] Benjamin JA., et al., 2014
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote ArcA-phosphorylated repressor acnBp1 131342 131356 -170.0 gaggcggtagTTTAAATTTTGACTAatcttgggat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
remote ArcA-phosphorylated repressor acnBp1 131369 131383 -143.0 cttgggattcGTTGAGAAAGGTGATtatcaccatg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
remote ArcA-phosphorylated repressor acnBp1 131373 131387 -139.0 ggattcgttgAGAAAGGTGATTATCaccatgcgaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
remote ArcA-phosphorylated repressor acnBp1 131393 131407 -119.0 ttatcaccatGCGAATTAACGAAGTttttacggag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-MICROARRAY], [COMP-AINF-PATTERN-DISCOVERY], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-CHIP] S [1], [6]
remote ArcA-phosphorylated repressor acnBp1 131399 131413 -113.0 ccatgcgaatTAACGAAGTTTTTACggagggaaac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
proximal ArcA-phosphorylated repressor acnBp1 131455 131469 -57.0 gattcagccaCTTTTTTATGTTGCTtttttgtaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
proximal ArcA-phosphorylated repressor acnBp1 131464 131478 -48.0 acttttttatGTTGCTTTTTTGTAAacagattaac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-MICROARRAY], [COMP-AINF-PATTERN-DISCOVERY], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-CHIP] S [1], [6]
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator acnBp1 131471 131492 -37.5 tatgttgcttTTTTGTAAACAGATTAACACCTcgtcaaaatc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
[Cra,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd Cra repressor acnBp1 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1]
[Fis,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis repressor acnBp1 131340 131354 -171.5 aagaggcggtAGTTTAAATTTTGACtaatcttggg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
proximal Fis repressor acnBp1 131438 131452 -73.5 tctagaccatCCTTAACGATTCAGCcactttttta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
proximal Fis repressor acnBp1 131482 131496 -29.5 tttgtaaacaGATTAACACCTCGTCaaaatcctgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [1]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB acnB repressor 131596 131624 GAGAGCGAGGAGAACCGUCGUGCUAGAAG TRANSLATION-BLOCKING, MRNA-DEGRADATION [EXP-IMP] [4], [5]


Transcription unit       
Name: acnB
Gene(s): acnB   Genome Browser M3D Gene expression COLOMBOS
Evidence: [IC] Inferred by curator
Promoter
Name: acnBp2
+1: 131564
Distance from start of the gene: 51
Sequence: tgctattctgcccgttgcggtactgggcatttaccctacaaactgctgtctcacaggagcGtgaagagaatcgcctgccgc
Evidence: [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
Reference(s): [3] Mendoza-Vargas A., et al., 2009


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -10.1 131367 131412 tcttgggattCGTTGAGAAAGGTGATTATCACCATGCGAATTAACGAAGTTTTTAcggagggaaa
  anti-terminator -7.0 131339 131385 aagaggcggtAGTTTAAATTTTGACTAATCTTGGGATTCGTTGAGAAAGGTGATTAtcaccatgcg
  anti-anti-terminator -4.3 131314 131346 cgcaggtgctGTGAATCCGAGTATAAAGAGGCGGTAGTTTAAattttgacta
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IEP-MICROARRAY] Expression microarray evidence

 [COMP-AINF-PATTERN-DISCOVERY] Automated inference based on sequence pattern discovery

 [EXP-CHIP-CHIP] ChIP-chip evidence

 [EXP-IMP] Inferred from mutant phenotype

 [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP] High-throughput transcription initiation mapping


Reference(s)    

 [1] Cunningham L., Gruer MJ., Guest JR., 1997, Transcriptional regulation of the aconitase genes (acnA and acnB) of Escherichia coli., Microbiology 143 ( Pt 12):3795-805

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [4] Benjamin JA., Masse E., 2014, The iron-sensing aconitase B binds its own mRNA to prevent sRNA-induced mRNA cleavage., Nucleic Acids Res 42(15):10023-36

 [5] Masse E., Vanderpool CK., Gottesman S., 2005, Effect of RyhB small RNA on global iron use in Escherichia coli., J Bacteriol 187(20):6962-71

 [6] Federowicz S., Kim D., Ebrahim A., Lerman J., Nagarajan H., Cho BK., Zengler K., Palsson B., 2014, Determining the control circuitry of redox metabolism at the genome-scale., PLoS Genet 10(4):e1004264

RegulonDB