![]() ![]() ![]() ![]() |
Name: | ompC | |||||||||
Synonym(s): | OP00065 | |||||||||
Gene(s): | ompC Genome Browser M3D Gene expression COLOMBOS | |||||||||
Note(s): | The ompC gene, which codes for one membrane porin, is positively regulated by EvgA (transcriptional activator of the EvgS/EvgA two-component system) Utsumi R, Katayama S, Taniguchi M, Horie T, Ikeda M, Igaki S, Nakagawa H, Miwa A, Tanabe H, Noda M,1994. Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M,1992 CpxR, and OmpR and negatively regulated by Lrp. The negative effect of Lrp, which is insensitive to leucine Ferrario M,1995 is shared with the divergent gene micF (an antisense RNA), as it binds at several sites along the intergenic and micF regions in an additive manner (the binding of one protein favors the binding of the others) Ferrario M,1995 It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that ompC gene expression is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L); this suggests that the product of this gene plays a role under this condition Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007 ompC is upregulated and downregulated in response to nalidixic acid (NA) and chlortetracycline (CTC), respectively, in parallel and in the opposite direction with atpB gene Lin X,2012 these changes are regulated by CpxR Lin X,2012 The expression of the gene ompC is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of three transcribing ompC, is affected by PhoB. |
|||||||||
Evidence: | [LTED] Length of transcript experimentally determined | |||||||||
Reference(s): |
[1] Huang L., et al., 1990 [2] Mizuno T., et al., 1983 |
|||||||||
Promoter | ||||||||||
Name: | ompCp1 | |||||||||
+1: | 2312830 | |||||||||
Sigma Factor: | Sigma70 Sigmulon | |||||||||
Distance from start of the gene: | 81 | |||||||||
Sequence: |
cttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacTtgccgactgattaatgaggg -35 -10 +1 |
|||||||||
Note(s): | OmpR transcriptional factor cooperatively binds to the sites of the upstream regions from the ompCp1 promoter in a discontinuous galloping manner, as described by Yoshida T,2006 | |||||||||
Evidence: |
[HTTIM] ![]() ![]() [ICWHO] [TIM] |
|||||||||
Reference(s): |
[1] Huang L., et al., 1990 [3] Huerta AM., et al., 2003 [4] Mendoza-Vargas A., et al., 2009 |
|||||||||
Terminator(s) | ||||||||||
Type: | rho-independent | |||||||||
Sequence: | caatgaaaaaAGGGCCCGCAGGCCCtttgttcgat | |||||||||
Reference(s): | [2] Mizuno T., et al., 1983 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | CpxR-phosphorylated | activator | ompCp1 | 2312920 | 2312931 | -95.0 | aagttcccttGCATTTACATTTtgaaacatct | nd | [GEA], [AIBSCS], [BPP] | [11] |
remote | CpxR-phosphorylated | activator | ompCp1 | 2312957 | 2312971 | -134.0 | atgttaggtgCTTATTTCGCCATTCcgcaataatc | nd | [GEA], [AIBSCS], [BPP] | [11] |
remote | CpxR-phosphorylated | activator | ompCp1 | 2313174 | 2313188 | -351.0 | tgaaaagtgtGTAAAGAAGGGTAAAaaaaaccgaa | nd | [GEA], [AIBSCS], [BPP] | [11] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | IHF | repressor | ompCp1 | 2313006 | 2313018 | -182.0 | tacttaagaaTAAGTTATTGATTttaaccttga | nd | [GEA], [APIORCISFBSCS], [BCE], [BPP] | nd |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | Lrp | repressor | ompCp1 | 2312738 | 2312752 | 86.0 | gagggttaatAACATGAAAGTTAAAgtactgtccc | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp-L-leucine | repressor | ompCp1 | 2312761 | 2312772 | 64.5 | gcaaataaagGCATATAACAGAgggttaataa | nd | [GEA], [BPP] | [9], [10] |
proximal | Lrp | repressor | ompCp1 | 2312822 | 2312836 | 2.0 | tttggggagaATGGACTTGCCGACTgattaatgag | nd | [GEA], [BPP] | [9], [10] |
proximal | Lrp | repressor | ompCp1 | 2312852 | 2312866 | -29.5 | tatcatattcGTGTTGGATTATTCTgcatttttgg | nd | [GEA], [AIBSCS], [BPP] | [9], [10], [21] |
remote | Lrp | repressor | ompCp1 | 2313103 | 2313117 | -280.5 | ttcagaaatgAATGACGGTAATAAAtaaagttaat | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp1 | 2313134 | 2313148 | -311.5 | ggcatccggtTGAAATAGGGGTAAAcagacattca | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp1 | 2313163 | 2313177 | -340.5 | taaagaagggTAAAAAAAACCGAATgcgaggcatc | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp1 | 2313199 | 2313213 | -376.0 | gtttttctgtGGTAGCACAGAATAAtgaaaagtgt | nd | [GEA], [BPP] | [9], [10] |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | OmpR-phosphorylated | activator | ompCp1 | 2312868 | 2312887 | -47.5 | gaaacatcttAAAAGTTTTAGTATCATATTcgtgttggat | nd | [GEA], [APIORCISFBSCS], [BPP], [SM] | [12], [14], [15], [16], [18], [20] |
proximal | OmpR-phosphorylated | activator | ompCp1 | 2312888 | 2312907 | -67.5 | aaacatctatAGCGATAAATGAAACATCTTaaaagtttta | nd | [GEA], [APIORCISFBSCS], [BPP], [SM] | [12], [14], [15], [16], [17], [18] |
proximal | OmpR-phosphorylated | activator | ompCp1 | 2312909 | 2312928 | -88.5 | ttcccttgcaTTTACATTTTGAAACATCTAtagcgataaa | nd | [GEA], [APIORCISFBSCS], [BPP], [SM] | [12], [13], [14], [15], [16], [17], [18] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA RybB | ompC | repressor | 2312750 | 2312782 | GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC | nd | [AH], [IEP], [IPI] | [5], [6] |
small regulatory RNA MicC | ompC | repressor | 2312764 | 2312790 | GUUAUAUGCCUUUAUUUGCUUUUUUAU | TRANSLATION-BLOCKING | [IEP], [SM] | [7] |
small regulatory RNA RseX | ompC | repressor | 2312750 | 2312780 | GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU | MRNA-DEGRADATION | [IEP] | [8] |
Name: | ompC | |||||||||
Gene(s): | ompC Genome Browser M3D Gene expression COLOMBOS | |||||||||
Note(s): | EvgA, the transcriptional activator of the two-component regulatory system EvgS/EvgA, positively regulates the transcription of the ompC gene, which codes for an outer membrane porin Utsumi R, Katayama S, Taniguchi M, Horie T, Ikeda M, Igaki S, Nakagawa H, Miwa A, Tanabe H, Noda M,1994. Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M,1992 It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that the ompC gene is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L); this suggests that the product of this gene plays a role under this condition Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007 Binding of Lrp to one site enhances occupancy of the other sites for Lrp in the ompCp2 promoter. Leucine does not abolish DNA binding by the ligated Lrp but it may alter the affinity of Lrp for specific sites on DNA. The expression of the gene ompC is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of three transcribing ompC, is affected by PhoB. |
|||||||||
Evidence: | [LTED] Length of transcript experimentally determined | |||||||||
Reference(s): | [1] Huang L., et al., 1990 | |||||||||
Promoter | ||||||||||
Name: | ompCp2 | |||||||||
+1: | 2312864 | |||||||||
Distance from start of the gene: | 115 | |||||||||
Sequence: |
cattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtGttggattattctgcattttt |
|||||||||
Evidence: | [TIM] | |||||||||
Reference(s): | [1] Huang L., et al., 1990 | |||||||||
Terminator(s) | ||||||||||
Type: | rho-independent | |||||||||
Sequence: | caatgaaaaaAGGGCCCGCAGGCCCtttgttcgat | |||||||||
Reference(s): | [2] Mizuno T., et al., 1983 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | Lrp | repressor | ompCp2 | 2312738 | 2312752 | 120.0 | gagggttaatAACATGAAAGTTAAAgtactgtccc | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp2 | 2312759 | 2312773 | 98.5 | agcaaataaaGGCATATAACAGAGGgttaataaca | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp2 | 2312822 | 2312836 | 36.0 | tttggggagaATGGACTTGCCGACTgattaatgag | nd | [GEA], [BPP] | [9], [10] |
proximal | Lrp | repressor | ompCp2 | 2312852 | 2312866 | 5.5 | tatcatattcGTGTTGGATTATTCTgcatttttgg | nd | [GEA], [AIBSCS], [BPP] | [9], [10], [21] |
remote | Lrp | repressor | ompCp2 | 2313031 | 2313045 | -174.0 | tttgttttgaCATTCAGTGCTGTCAaatacttaag | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp2 | 2313103 | 2313117 | -246.5 | ttcagaaatgAATGACGGTAATAAAtaaagttaat | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp2 | 2313134 | 2313148 | -277.5 | ggcatccggtTGAAATAGGGGTAAAcagacattca | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp2 | 2313163 | 2313177 | -306.5 | taaagaagggTAAAAAAAACCGAATgcgaggcatc | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp2 | 2313199 | 2313213 | -342.0 | gtttttctgtGGTAGCACAGAATAAtgaaaagtgt | nd | [GEA], [BPP] | [9], [10] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA RybB | ompC | repressor | 2312750 | 2312782 | GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC | nd | [AH], [IEP], [IPI] | [5], [6] |
small regulatory RNA RseX | ompC | repressor | 2312750 | 2312780 | GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU | MRNA-DEGRADATION | [IEP] | [8] |
small regulatory RNA MicC | ompC | repressor | 2312764 | 2312790 | GUUAUAUGCCUUUAUUUGCUUUUUUAU | TRANSLATION-BLOCKING | [IEP], [SM] | [7] |
Name: | ompC | |||||||||
Gene(s): | ompC Genome Browser M3D Gene expression COLOMBOS | |||||||||
Note(s): | EvgA, the transcriptional activator of the two-component regulatory system EvgS/EvgA, positively regulates the transcription of the ompC gene, which codes for an outer membrane porin Utsumi R, Katayama S, Taniguchi M, Horie T, Ikeda M, Igaki S, Nakagawa H, Miwa A, Tanabe H, Noda M,1994. Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M,1992 It was proved in an experiment with increasing concentrations of the antibiotic tetracycline that the ompC gene is induced in low concentrations (1.5 and 4 mg/L), but not in high ones (10 mg/L); this suggests that the product of this gene plays a role under this condition Viveiros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, Amaral L,2007 Binding of Lrp to one site enhances occupancy of the other sites for Lrp in the ompCp3 promoter. Leucine does not abolish DNA binding by the ligated Lrp but it may alter the affinity of Lrp for specific sites on DNA. The expression of the gene ompC is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013 The increased expression under aerobiosis appears to be caused by the transcription factor PhoB Marzan LW,2013 but it is not known which promoter, of three transcribing ompC, is affected by PhoB. |
|||||||||
Evidence: | [LTED] Length of transcript experimentally determined | |||||||||
Reference(s): | [1] Huang L., et al., 1990 | |||||||||
Promoter | ||||||||||
Name: | ompCp3 | |||||||||
+1: | 2312887 | |||||||||
Distance from start of the gene: | 138 | |||||||||
Sequence: |
cttaaaaagttcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttAaaagttttagtatcatattc |
|||||||||
Evidence: | [TIM] | |||||||||
Reference(s): | [1] Huang L., et al., 1990 | |||||||||
Terminator(s) | ||||||||||
Type: | rho-independent | |||||||||
Sequence: | caatgaaaaaAGGGCCCGCAGGCCCtttgttcgat | |||||||||
Reference(s): | [2] Mizuno T., et al., 1983 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | IHF | repressor | ompCp3 | 2313006 | 2313018 | -125.0 | tacttaagaaTAAGTTATTGATTttaaccttga | nd | [GEA], [APIORCISFBSCS], [BCE], [BPP] | nd |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
remote | Lrp | repressor | ompCp3 | 2312738 | 2312752 | 143.0 | gagggttaatAACATGAAAGTTAAAgtactgtccc | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp3 | 2312759 | 2312773 | 121.5 | agcaaataaaGGCATATAACAGAGGgttaataaca | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp3 | 2312822 | 2312836 | 59.0 | tttggggagaATGGACTTGCCGACTgattaatgag | nd | [GEA], [BPP] | [9], [10] |
proximal | Lrp | repressor | ompCp3 | 2312853 | 2312867 | 28.0 | gtatcatattCGTGTTGGATTATTCtgcatttttg | nd | [GEA], [AIBSCS], [BPP] | [9], [10], [21] |
remote | Lrp | repressor | ompCp3 | 2313031 | 2313045 | -151.0 | tttgttttgaCATTCAGTGCTGTCAaatacttaag | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp3 | 2313103 | 2313117 | -223.5 | ttcagaaatgAATGACGGTAATAAAtaaagttaat | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp3 | 2313134 | 2313148 | -254.5 | ggcatccggtTGAAATAGGGGTAAAcagacattca | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp3 | 2313163 | 2313177 | -283.5 | taaagaagggTAAAAAAAACCGAATgcgaggcatc | nd | [GEA], [BPP] | [9], [10] |
remote | Lrp | repressor | ompCp3 | 2313199 | 2313213 | -319.0 | gtttttctgtGGTAGCACAGAATAAtgaaaagtgt | nd | [GEA], [BPP] | [9], [10] |
sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
---|---|---|---|---|---|---|---|---|
PosLeft | PosRight | Target sequence (mRNA) | ||||||
small regulatory RNA MicC | ompC | repressor | 2312764 | 2312790 | GUUAUAUGCCUUUAUUUGCUUUUUUAU | TRANSLATION-BLOCKING | [IEP], [SM] | [7] |
small regulatory RNA RseX | ompC | repressor | 2312750 | 2312780 | GUUAUUAACCCUCUGUUAUAUGCCUUUAUUU | MRNA-DEGRADATION | [IEP] | [8] |
small regulatory RNA RybB | ompC | repressor | 2312750 | 2312782 | GUUAUUAACCCUCUGUUAUAUGCCUUUAUUUGC | nd | [AH], [IEP], [IPI] | [5], [6] |
Reference(s) |
![]() |
---|---|