RegulonDB RegulonDB 10.10: Operon Form
   

nmpC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: nmpC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: nmpC
Synonym(s): lc, phmA, phmA/nmpC
Gene(s): nmpC   Genome Browser M3D Gene expression COLOMBOS
Note(s): Based on microarray and RT-qPCR analyses, it was determined that the yebF and nmpC genes are up- and downregulated, respectively, upon exposure to glutathione (GSH) Goswami M,2018
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Blasband AJ., et al., 1986
[2] Coll JL., et al., 1994
Promoter
Name: nmpCp
+1: 576870
Distance from start of the gene:
Sequence:
Evidence: [HIPP]
[TIM]
Reference(s): [1] Blasband AJ., et al., 1986
[2] Coll JL., et al., 1994
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator nmpCp 576891 576912 -31.5 accaaaacttACATCTTGAAATAATCACATTGattagatgaa nd [APIORCISFBSCS], [SM] [2]
proximal CRP-cyclic-AMP activator nmpCp 576933 576954 -73.5 ttcagataaaAATAGAGATCTACTTCACAAATcaaacgagaa nd [APIORCISFBSCS], [SM] [2]
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF repressor nmpCp 577008 577020 -144.0 ataaattggcTAATAGATTTATTtttattcagc nd [APIORCISFBSCS], [SM] [2]
[MprA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote MprA repressor nmpCp 577021 577041 -161.0 ttataaataaCAGCCGTTAATATAAATTGGCtaatagattt nd [AIBSCS] [4]
[OmpR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated repressor nmpCp 576906 576925 -45.5 aatcaaacgaGAAACCAAAACTTACATCTTgaaataatca nd [APIORCISFBSCS], [SM] [2]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB nmpC repressor 576806 576834 GCCACUGUUAAUUUUUUCAUCGUGAGCCC nd [SM] [3]


Evidence    

 [HIPP] Human inference of promoter position

 [TIM] Transcription initiation mapping

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [SM] Site mutation

 [AIBSCS] Automated inference based on similarity to consensus sequences


Reference(s)    

 [1] Blasband AJ., Marcotte WR., Schnaitman CA., 1986, Structure of the lc and nmpC outer membrane porin protein genes of lambdoid bacteriophage., J Biol Chem 261(27):12723-32

 [2] Coll JL., Heyde M., Portalier R., 1994, Expression of the nmpC gene of Escherichia coli K-12 is modulated by external pH. Identification of cis-acting regulatory sequences involved in this regulation., Mol Microbiol 12(1):83-93

 [3] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [4] Rodionov DA., Gelfand MS., Mironov AA., Rakhmaninova AB., 2001, Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria., J Mol Microbiol Biotechnol 3(2):319-24

RegulonDB