RegulonDB RegulonDB 10.10: Operon Form

csgDEFG operon and associated TUs in Escherichia coli K-12 genome

Name: csgDEFG
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: csgDEFG
Gene(s): csgG, csgF, csgE, csgD   Genome Browser M3D Gene expression COLOMBOS
Note(s): High concentrations of intracellular GlcNAc-6P signal the cells to downregulate the csgBA and csgDEFG operons Barnhart MM, Lynem J, Chapman MR,2006
Evidence: [BTEI] Boundaries of transcription experimentally identified
[PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [1] Ogasawara H., et al., 2007
Name: csgDp
+1: 1103335
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 139
Sequence: tagttacatgtttaacacttgatttaagatttgtaatggctagattgaaatcagatgtaaTccattagttttatattttac
                   -35                   -10                +1                   
Evidence: [IHBCE]
Reference(s): [2] Dudin O., et al., 2013
[1] Ogasawara H., et al., 2007
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd FliZ repressor csgDp nd nd nd nd nd [GEA], [BPP] [4], [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RstA-phosphorylated repressor csgDp 1103388 1103402 -59.5 atataacgagTTACATTTAGTTACAtgtttaacac nd [GEA], [APIORCISFBSCS], [BPP] [1], [3]

Transcription unit          
Name: csgDEFG
Gene(s): csgG, csgF, csgE, csgD   Genome Browser M3D Gene expression COLOMBOS
Note(s): High concentrations of intracellular GlcNAc-6P signal the cells to downregulate the csgBA and csgDEFG operons Barnhart MM, Lynem J, Chapman MR,2006
Evidence: [BTEI] Boundaries of transcription experimentally identified
[PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [1] Ogasawara H., et al., 2007
Name: csgDp2
+1: 1103335
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 139
Sequence: tagttacatgtttaacacttgatttaagatttgtaatggctagattgaaatcagatgtaaTccattagttttatattttac
                        -35                     -10         +1                   
Evidence: [ICWHO]
Reference(s): [6] Huerta AM., et al., 2003
[1] Ogasawara H., et al., 2007
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd FliZ repressor csgDp2 nd nd nd nd nd [GEA], [BPP] [4], [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RstA-phosphorylated repressor csgDp2 1103388 1103402 -59.5 atataacgagTTACATTTAGTTACAtgtttaacac nd [GEA], [APIORCISFBSCS], [BPP] [1], [3]

Transcription unit          
Name: csgDEFG
Gene(s): csgG, csgF, csgE, csgD   Genome Browser M3D Gene expression COLOMBOS
Note(s): This operon encodes several proteins involved in the control of expression of the curli subunits encoded by csgBA.
There are nine elements involved in the regulation of curli expression through a complex network of interactions between transcription factors and the csg regulatory region Jubelin G,2005.
FruR (Cra) binds to four target sites in the csgDEFG-csgBAC intergenic region and has the ability to bend the DNA to activate the transcription of these operons, but there is a possibility that FruR may indirectly regulate the expression of the operon csgBAC via the regulator CsgD Reshamwala SM,2011.
in vitro experiments demonstrated that OmpR and CpxR bind simultaneously at the csgD promoter; for this reason, a competition between both could exist, allowing for a gradual curli gene expression. OmpR can bind only to a one site at the csgD promoter region, whereas CpxR binds cooperatively to multiple sites at the csg intergenic region, affecting to both csgBA and csgDEFG operons. The Cpx metabolic pathway is activated by high osmolarity, and this way CpxR represses the transcription of csgD in response to this condition Jubelin G,2005.
DnaK increases the expression of the csgBAC and csgDEFG operons, which are responsible for curli production, via quantity and quality control of RpoS and CsgD Sugimoto S,2018
High concentrations of intracellular GlcNAc-6P signal the cells to downregulate the csgBA and csgDEFG operons Barnhart MM, Lynem J, Chapman MR,2006
IHF and CpxR have high affinity for the csgDp1 promoter, followed in declining affinity by
OmpR, H-NS, and RstA Ogasawara H,2010.
Two regions have been designated as hot spot I and hot spot II. In the hot spot I region,
IHF, CpxR, and H-NS bind to the same upstream region between -188 and -159, while in the hot spot
II region, IHF, CpxR, H-NS, OmpR, and RstA bind at the downstream region between -61 and -43
Ogasawara H,2010.
IHF and H-NS compete with each other for binding to the respective target sequences in the
presence of high concentrations of both proteins Ogasawara H,2010.
In studies using DNase I footprinting, it was shown that H-NS binds a long sequence of 229 bp upstream of the csgDp1 promoter, from -201 to +28, including AT-rich sequences and the site where H-NS
is silencing to this promoter, and the sequence probably includes four binding sites, covering almost the entirety of this region Ogasawara H,2010. However, specific sequences where H-NS binds were not shown.
csgD expression is controlled through two diguanylate cyclases (DGCs), YegE and YdaM, and two phosphodiesterases (PDEs), YhjH and Gmr, and by the transcriptional regulator MlrA through a signaling cascade that controls curli biosynthesis by reducing transcription of the regulator CsgD Lindenberg S, Klauck G, Pesavento C, Klauck E, Hengge R,2013.
Based on gene expression analysis, it was determined that Fis activates csgD expression Amores GR,2017
Epigallocatechin gallate (EGCG) activates the σE pathway, blocking the transcription of csgD through CpxR Nie T, Zhang C, Huang A, Li P,2018
The csgD gene is upregulated by long-term (8 to 12 h) exposure of E. coli to some biocides Merchel Piovesan Pereira B, Wang X, Tagkopoulos I,2020.
Evidence: [BTEI] Boundaries of transcription experimentally identified
[PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [1] Ogasawara H., et al., 2007
Name: csgDp1
+1: 1103344
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 148
Sequence: agttacatttagttacatgtttaacacttgatttaagatttgtaatggctagattgaaatCagatgtaatccattagtttt
                            -35                   -10       +1                   
Evidence: [ICWHO]
Reference(s): [7] Hammar M., et al., 1995
[6] Huerta AM., et al., 2003
[1] Ogasawara H., et al., 2007
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal BasR-phosphorylated activator csgDp1 1103425 1103444 -90.5 tatcatttctAAACTTAATAAAACCTTAAGgttaacattt nd [GEA], [APIORCISFBSCS], [BPP] [21]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote BtsR-Phosphorylated repressor csgDp1 1103303 1103314 37.0 tatattttacCCATTTAGGGCTgatttattac nd [GEA], [AIBSPD], [GS] [24]
proximal BtsR-Phosphorylated repressor csgDp1 1103364 1103375 -25.0 tttaacacttGATTTAAGATTTgtaatggcta nd [GEA], [AIBSPD], [GS] [24]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator csgDp1 1103376 1103397 -42.5 acgagttacaTTTAGTTACATGTTTAACACTTgatttaagat nd [GEA], [AIBSCS] [16], [17]
remote CRP-cyclic-AMP activator csgDp1 1103504 1103525 -170.5 tttatatgcaTTATTAGTAAGTTATCACCATTtgtatgattt nd [GEA], [AIBSCS] [17]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated repressor csgDp1 1103335 1103349 3.0 tggctagattGAAATCAGATGTAATccattagttt nd [GEA], [APIORCISFBSCS], [BPP] [20]
proximal CpxR-phosphorylated repressor csgDp1 1103359 1103373 -21.5 taacacttgaTTTAAGATTTGTAATggctagattg nd [GEA], [APIORCISFBSCS], [BPP] [3], [20]
proximal CpxR-phosphorylated repressor csgDp1 1103380 1103394 -43.0 agttacatttAGTTACATGTTTAACacttgattta nd [GEA], [APIORCISFBSCS], [BPP] [3]
proximal CpxR-phosphorylated repressor csgDp1 1103385 1103399 -48.0 taacgagttaCATTTAGTTACATGTttaacacttg nd [GEA], [APIORCISFBSCS], [BPP] [20]
proximal CpxR-phosphorylated repressor csgDp1 1103389 1103403 -52.0 aatataacgaGTTACATTTAGTTACatgtttaaca nd [GEA], [APIORCISFBSCS], [BPP] [20], [23]
proximal CpxR-phosphorylated repressor csgDp1 1103411 1103425 -73.5 aaaaccttaaGGTTAACATTTTAATataacgagtt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103433 1103447 -95.5 ttctatcattTCTAAACTTAATAAAaccttaaggt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103437 1103451 -100.0 acttttctatCATTTCTAAACTTAAtaaaacctta nd [GEA], [APIORCISFBSCS], [BPP] [3], [20]
remote CpxR-phosphorylated repressor csgDp1 1103446 1103460 -108.5 aaatgtacaaCTTTTCTATCATTTCtaaacttaat nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103466 1103482 -129.5 ttaaaattgtGCAATAAAAACCAAATGtacaactttt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103478 1103492 -141.0 gtatgattttTTAAAATTGTGCAATaaaaaccaaa nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103503 1103517 -166.0 cattattagtAAGTTATCACCATTTgtatgatttt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103516 1103529 -178.0 attttttataTGCATTATTAGTAAgttatcacca nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp1 1103523 1103537 -186.0 accgaaatatTTTTTATATGCATTAttagtaagtt nd [GEA], [APIORCISFBSCS], [BPP] [3]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Cra activator csgDp1 1103290 1103307 46.5 tacccatttaGGGCTGATTTATTACTACacacagcagt nd [GEA], [AIBSCS], [BPP], [SM] [14]
remote Cra activator csgDp1 1103532 1103549 -196.5 cgaaaggactACACCGAAATATTTTTTAtatgcattat nd [GEA], [AIBSCS], [BPP], [SM] [14]
remote Cra activator csgDp1 1103563 1103580 -227.5 tgtggagaaaAAACAAGAACGTTTTACAtgacgaaagg nd [GEA], [AIBSCS], [BPP], [SM] [14]
remote Cra activator csgDp1 1103899 1103916 -563.5 catttaagaaATTAAATCATTTCAACTTggttgttaac nd [GEA], [AIBSCS], [BPP] [14]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CsgD activator csgDp1 1103309 1103323 29.5 cattagttttATATTTTACCCATTTagggctgatt nd [GEA], [APIORCISFBSCS], [BPP] [18]
proximal CsgD activator csgDp1 1103329 1103343 9.5 gattgaaatcAGATGTAATCCATTAgttttatatt nd [GEA], [APIORCISFBSCS], [BPP] [18]
remote CsgD activator csgDp1 1103456 1103470 -118.5 aataaaaaccAAATGTACAACTTTTctatcatttc nd [GEA], [APIORCISFBSCS], [BPP] [18]
remote CsgD activator csgDp1 1103504 1103518 -166.5 gcattattagTAAGTTATCACCATTtgtatgattt nd [GEA], [APIORCISFBSCS], [BPP] [18]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd FliZ repressor csgDp1 nd nd nd nd nd [GEA], [BPP] [4], [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor csgDp1 nd nd nd nd nd [GEA], [BPP] [3]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF activator csgDp1 1103381 1103441 -66.5 catttctaaaCTTAATAAAACCTTAAGGTTAACATTTTAATATAACGAGTTACATTTAGTTACATGTTTAAcacttgattt nd [GEA], [BPP] [3]
remote IHF activator csgDp1 1103503 1103533 -173.5 aaatatttttTATATGCATTATTAGTAAGTTATCACCATTTgtatgatttt nd [GEA], [BPP] [3], [16]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote MlrA activator csgDp1 1103457 1103491 -129.5 tatgatttttTAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt nd [GEA], [BPP] [19]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MqsA repressor csgDp1 1103421 1103434 -83.5 aaacttaataAAACCTTAAGGTTAacattttaat nd [GEA], [APIORCISFBSCS], [BPP] [22]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated activator csgDp1 1103384 1103403 -49.5 aatataacgaGTTACATTTAGTTACATGTTtaacacttga nd [GEA], [APIORCISFBSCS], [BPP] [3], [20], [23]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote RcdA activator csgDp1 1103638 1103648 -298.5 tgcgatatgtCTTGCGCACAAgccgtgacaa nd [GEA], [IC], [BPP], [IC] [15]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd RcsAB repressor csgDp1 nd nd nd nd nd [GEA], [BPP] [25]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RstA-phosphorylated repressor csgDp1 1103388 1103402 -50.5 atataacgagTTACATTTAGTTACAtgtttaacac nd [GEA], [APIORCISFBSCS], [BPP] [1], [3]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA OmrA csgDEFG repressor 1103257 1103275 CCAGAAGUACUGACAGAUG TRANSLATION-BLOCKING [IDA], [SM] [8]
small regulatory RNA GcvB csgDEFG repressor 1103272 1103289 GAUGUUGCACUGCUGUGU MRNA-DEGRADATION [IDA], [IEP] [9], [10]
small regulatory RNA RydC csgDEFG repressor 1103194 1103215 CAUGAUGAAACCCCGCUUUUUU TRANSLATION-BLOCKING [IEP], [IMP] [11]
small regulatory RNA McaS csgDEFG repressor 1103277 1103291 UGCACUGCUGUGUGU MRNA-DEGRADATION [GEA], [IDA], [IPI], [SM] [9], [10]
small regulatory RNA OmrB csgDEFG repressor 1103257 1103275 CCAGAAGUACUGACAGAUG TRANSLATION-BLOCKING [IDA], [SM] [8]
small regulatory RNA RprA csgDEFG repressor 1103190 1103210 UAAACAUGAUGAAACCCCGCU TRANSLATION-BLOCKING, MRNA-DEGRADATION [SM] [9], [12]
small regulatory RNA RybB csgDEFG repressor 1103278 1103285 GCACUGCU nd [IEP], [SM] [13]

Transcription unit          
Name: csgDEFG
Gene(s): csgG, csgF, csgE, csgD   Genome Browser M3D Gene expression COLOMBOS
Note(s): This operon encodes several proteins involved in the control of expression of the curli subunits encoded by csgBA.
There are nine elements involved in the regulation of curli expression through a complex network of interactions between transcription factors and the csg regulatory region Jubelin G,2005.
FruR (Cra) binds to four target sites in the csgDEFG-csgBAC intergenic region and has the ability to bend the DNA to activate the transcription of these operons, but there is a possibility that FruR may indirectly regulate the expression of the operon csgBAC via the regulator CsgD Reshamwala SM,2011.
in vitro experiments demonstrated that OmpR and CpxR bind simultaneously at the csgD promoter; for this reason, a competition between both could exist, allowing for a gradual curli gene expression. OmpR can bind only to a one site at the csgD promoter region, whereas CpxR binds cooperatively to multiple sites at the csg intergenic region, affecting to both csgBA and csgDEFG operons. The Cpx metabolic pathway is activated by high osmolarity, and this way CpxR represses the transcription of csgD in response to this condition Jubelin G,2005.
DnaK increases the expression of the csgBAC and csgDEFG operons, which are responsible for curli production, via quantity and quality control of RpoS and CsgD Sugimoto S,2018
High concentrations of intracellular GlcNAc-6P signal the cells to downregulate the csgBA and csgDEFG operons Barnhart MM, Lynem J, Chapman MR,2006
IHF and CpxR have high affinity for the csgDp1 promoter, followed in declining affinity by
OmpR, H-NS, and RstA Ogasawara H,2010.
Two regions have been designated as hot spot I and hot spot II. In the hot spot I region,
IHF, CpxR, and H-NS bind to the same upstream region between -188 and -159, while in the hot spot
II region, IHF, CpxR, H-NS, OmpR, and RstA bind at the downstream region between -61 and -43
Ogasawara H,2010.
IHF and H-NS compete with each other for binding to the respective target sequences in the
presence of high concentrations of both proteins Ogasawara H,2010.
In studies using DNase I footprinting, it was shown that H-NS binds a long sequence of 229 bp upstream of the csgDp1 promoter, from -201 to +28, including AT-rich sequences and the site where H-NS
is silencing to this promoter, and the sequence probably includes four binding sites, covering almost the entirety of this region Ogasawara H,2010. However, specific sequences where H-NS binds were not shown.
csgD expression is controlled through two diguanylate cyclases (DGCs), YegE and YdaM, and two phosphodiesterases (PDEs), YhjH and Gmr, and by the transcriptional regulator MlrA through a signaling cascade that controls curli biosynthesis by reducing transcription of the regulator CsgD Lindenberg S, Klauck G, Pesavento C, Klauck E, Hengge R,2013.
Based on gene expression analysis, it was determined that Fis activates csgD expression Amores GR,2017
Epigallocatechin gallate (EGCG) activates the σE pathway, blocking the transcription of csgD through CpxR Nie T, Zhang C, Huang A, Li P,2018
Evidence: [BTEI] Boundaries of transcription experimentally identified
[PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [1] Ogasawara H., et al., 2007
Name: csgDp3
+1: 1103344
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 148
Sequence: agttacatttagttacatgtttaacacttgatttaagatttgtaatggctagattgaaatCagatgtaatccattagtttt
                            -35              -10            +1                   
Evidence: [ICWHO]
Reference(s): [26] Dudin O., et al., 2014
[7] Hammar M., et al., 1995
[6] Huerta AM., et al., 2003
[1] Ogasawara H., et al., 2007
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal BasR-phosphorylated activator csgDp3 1103425 1103444 -90.5 tatcatttctAAACTTAATAAAACCTTAAGgttaacattt nd [GEA], [APIORCISFBSCS], [BPP] [21]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd BolA-phosphorylated activator csgDp3 nd nd nd nd nd [GEA], [BPP] [27]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote BtsR-Phosphorylated repressor csgDp3 1103303 1103314 37.0 tatattttacCCATTTAGGGCTgatttattac nd [GEA], [AIBSPD], [GS] [24]
proximal BtsR-Phosphorylated repressor csgDp3 1103364 1103375 -25.0 tttaacacttGATTTAAGATTTgtaatggcta nd [GEA], [AIBSPD], [GS] [24]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator csgDp3 1103376 1103397 -42.5 acgagttacaTTTAGTTACATGTTTAACACTTgatttaagat nd [GEA], [AIBSCS] [16], [17]
remote CRP-cyclic-AMP activator csgDp3 1103504 1103525 -170.5 tttatatgcaTTATTAGTAAGTTATCACCATTtgtatgattt nd [GEA], [AIBSCS] [17]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated repressor csgDp3 1103335 1103349 3.0 tggctagattGAAATCAGATGTAATccattagttt nd [GEA], [APIORCISFBSCS], [BPP] [20]
proximal CpxR-phosphorylated repressor csgDp3 1103359 1103373 -21.5 taacacttgaTTTAAGATTTGTAATggctagattg nd [GEA], [APIORCISFBSCS], [BPP] [3], [20]
proximal CpxR-phosphorylated repressor csgDp3 1103380 1103394 -43.0 agttacatttAGTTACATGTTTAACacttgattta nd [GEA], [APIORCISFBSCS], [BPP] [3]
proximal CpxR-phosphorylated repressor csgDp3 1103385 1103399 -48.0 taacgagttaCATTTAGTTACATGTttaacacttg nd [GEA], [APIORCISFBSCS], [BPP] [20]
proximal CpxR-phosphorylated repressor csgDp3 1103389 1103403 -52.0 aatataacgaGTTACATTTAGTTACatgtttaaca nd [GEA], [APIORCISFBSCS], [BPP] [20], [23]
proximal CpxR-phosphorylated repressor csgDp3 1103411 1103425 -73.5 aaaaccttaaGGTTAACATTTTAATataacgagtt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103433 1103447 -95.5 ttctatcattTCTAAACTTAATAAAaccttaaggt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103437 1103451 -100.0 acttttctatCATTTCTAAACTTAAtaaaacctta nd [GEA], [APIORCISFBSCS], [BPP] [3], [20]
remote CpxR-phosphorylated repressor csgDp3 1103446 1103460 -108.5 aaatgtacaaCTTTTCTATCATTTCtaaacttaat nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103466 1103482 -129.5 ttaaaattgtGCAATAAAAACCAAATGtacaactttt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103478 1103492 -141.0 gtatgattttTTAAAATTGTGCAATaaaaaccaaa nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103503 1103517 -166.0 cattattagtAAGTTATCACCATTTgtatgatttt nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103516 1103529 -178.0 attttttataTGCATTATTAGTAAgttatcacca nd [GEA], [APIORCISFBSCS], [BPP] [3]
remote CpxR-phosphorylated repressor csgDp3 1103523 1103537 -186.0 accgaaatatTTTTTATATGCATTAttagtaagtt nd [GEA], [APIORCISFBSCS], [BPP] [3]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Cra activator csgDp3 1103290 1103307 46.5 tacccatttaGGGCTGATTTATTACTACacacagcagt nd [GEA], [AIBSCS], [BPP], [SM] [14]
remote Cra activator csgDp3 1103532 1103549 -196.5 cgaaaggactACACCGAAATATTTTTTAtatgcattat nd [GEA], [AIBSCS], [BPP], [SM] [14]
remote Cra activator csgDp3 1103563 1103580 -227.5 tgtggagaaaAAACAAGAACGTTTTACAtgacgaaagg nd [GEA], [AIBSCS], [BPP], [SM] [14]
remote Cra activator csgDp3 1103899 1103916 -563.5 catttaagaaATTAAATCATTTCAACTTggttgttaac nd [GEA], [AIBSCS], [BPP] [14]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CsgD activator csgDp3 1103309 1103323 29.5 cattagttttATATTTTACCCATTTagggctgatt nd [GEA], [APIORCISFBSCS], [BPP] [18]
proximal CsgD activator csgDp3 1103329 1103343 9.5 gattgaaatcAGATGTAATCCATTAgttttatatt nd [GEA], [APIORCISFBSCS], [BPP] [18]
remote CsgD activator csgDp3 1103456 1103470 -118.5 aataaaaaccAAATGTACAACTTTTctatcatttc nd [GEA], [APIORCISFBSCS], [BPP] [18]
remote CsgD activator csgDp3 1103504 1103518 -166.5 gcattattagTAAGTTATCACCATTtgtatgattt nd [GEA], [APIORCISFBSCS], [BPP] [18]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd FliZ repressor csgDp3 nd nd nd nd nd [GEA], [BPP] [4], [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor csgDp3 nd nd nd nd nd [GEA], [BPP] [3]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF activator csgDp3 1103381 1103441 -66.5 catttctaaaCTTAATAAAACCTTAAGGTTAACATTTTAATATAACGAGTTACATTTAGTTACATGTTTAAcacttgattt nd [GEA], [BPP] [3]
remote IHF activator csgDp3 1103503 1103533 -173.5 aaatatttttTATATGCATTATTAGTAAGTTATCACCATTTgtatgatttt nd [GEA], [BPP] [3], [16]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote MlrA activator csgDp3 1103457 1103491 -129.5 tatgatttttTAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt nd [GEA], [BPP] [19]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MqsA repressor csgDp3 1103421 1103434 -83.5 aaacttaataAAACCTTAAGGTTAacattttaat nd [GEA], [APIORCISFBSCS], [BPP] [22]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated activator csgDp3 1103384 1103403 -49.5 aatataacgaGTTACATTTAGTTACATGTTtaacacttga nd [GEA], [APIORCISFBSCS], [BPP] [3], [20], [23]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote RcdA activator csgDp3 1103638 1103648 -298.5 tgcgatatgtCTTGCGCACAAgccgtgacaa nd [GEA], [IC], [BPP], [IC] [15]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd RcsAB repressor csgDp3 nd nd nd nd nd [GEA], [BPP] [25]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RstA-phosphorylated repressor csgDp3 1103388 1103402 -50.5 atataacgagTTACATTTAGTTACAtgtttaacac nd [GEA], [APIORCISFBSCS], [BPP] [1], [3]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA McaS csgDEFG repressor 1103277 1103291 UGCACUGCUGUGUGU MRNA-DEGRADATION [GEA], [IDA], [IPI], [SM] [9], [10]
small regulatory RNA GcvB csgDEFG repressor 1103272 1103289 GAUGUUGCACUGCUGUGU MRNA-DEGRADATION [IDA], [IEP] [9], [10]
small regulatory RNA RydC csgDEFG repressor 1103194 1103215 CAUGAUGAAACCCCGCUUUUUU TRANSLATION-BLOCKING [IEP], [IMP] [11]
small regulatory RNA OmrA csgDEFG repressor 1103257 1103275 CCAGAAGUACUGACAGAUG TRANSLATION-BLOCKING [IDA], [SM] [8]
small regulatory RNA RprA csgDEFG repressor 1103190 1103210 UAAACAUGAUGAAACCCCGCU TRANSLATION-BLOCKING, MRNA-DEGRADATION [SM] [9], [12]
small regulatory RNA RybB csgDEFG repressor 1103278 1103285 GCACUGCU nd [IEP], [SM] [13]
small regulatory RNA OmrB csgDEFG repressor 1103257 1103275 CCAGAAGUACUGACAGAUG TRANSLATION-BLOCKING [IDA], [SM] [8]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp activation csgDp3 nd   [GEA] [28]
Evidence: [GEA] Gene expression analysis
Reference(s): [28] Yamanaka K., et al., 1997


 [1] Ogasawara H., Hasegawa A., Kanda E., Miki T., Yamamoto K., Ishihama A., 2007, Genomic SELEX search for target promoters under the control of the PhoQP-RstBA signal relay cascade., J Bacteriol 189(13):4791-9

 [2] Dudin O., Lacour S., Geiselmann J., 2013, Expression dynamics of RpoS/Crl-dependent genes in Escherichia coli., Res Microbiol 164(8):838-47

 [3] Ogasawara H., Yamada K., Kori A., Yamamoto K., Ishihama A., 2010, Regulation of the Escherichia coli csgD promoter: interplay between five transcription factors., Microbiology 156(Pt 8):2470-83

 [4] Pesavento C., Becker G., Sommerfeldt N., Possling A., Tschowri N., Mehlis A., Hengge R., 2008, Inverse regulatory coordination of motility and curli-mediated adhesion in Escherichia coli., Genes Dev 22(17):2434-46

 [5] Pesavento C., Hengge R., 2012, The global repressor FliZ antagonizes gene expression by σS-containing RNA polymerase due to overlapping DNA binding specificity., Nucleic Acids Res 40(11):4783-93

 [6] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [7] Hammar M., Arnqvist A., Bian Z., Olsen A., Normark S., 1995, Expression of two csg operons is required for production of fibronectin- and congo red-binding curli polymers in Escherichia coli K-12., Mol Microbiol 18(4):661-70

 [8] Holmqvist E., Reimegard J., Sterk M., Grantcharova N., Romling U., Wagner EG., 2010, Two antisense RNAs target the transcriptional regulator CsgD to inhibit curli synthesis., EMBO J 29(11):1840-50

 [9] Andreassen PR., Pettersen JS., Szczerba M., Valentin-Hansen P., Moller-Jensen J., Jorgensen MG., 2018, sRNA-dependent control of curli biosynthesis in Escherichia coli: McaS directs endonucleolytic cleavage of csgD mRNA., Nucleic Acids Res 46(13):6746-6760

 [10] Jorgensen MG., Nielsen JS., Boysen A., Franch T., Moller-Jensen J., Valentin-Hansen P., 2012, Small regulatory RNAs control the multi-cellular adhesive lifestyle of Escherichia coli., Mol Microbiol 84(1):36-50

 [11] Bordeau V., Felden B., 2014, Curli synthesis and biofilm formation in enteric bacteria are controlled by a dynamic small RNA module made up of a pseudoknot assisted by an RNA chaperone., Nucleic Acids Res 42(7):4682-96

 [12] Mika F., Busse S., Possling A., Berkholz J., Tschowri N., Sommerfeldt N., Pruteanu M., Hengge R., 2012, Targeting of csgD by the small regulatory RNA RprA links stationary phase, biofilm formation and cell envelope stress in Escherichia coli., Mol Microbiol 84(1):51-65

 [13] Serra DO., Mika F., Richter AM., Hengge R., 2016, The green tea polyphenol EGCG inhibits E. coli biofilm formation by impairing amyloid curli fibre assembly and downregulating the biofilm regulator CsgD via the σ(E) -dependent sRNA RybB., Mol Microbiol 101(1):136-51

 [14] Reshamwala SM., Noronha SB., 2011, Biofilm formation in Escherichia coli cra mutants is impaired due to down-regulation of curli biosynthesis., Arch Microbiol 193(10):711-22

 [15] Shimada T., Katayama Y., Kawakita S., Ogasawara H., Nakano M., Yamamoto K., Ishihama A., 2012, A novel regulator RcdA of the csgD gene encoding the master regulator of biofilm formation in Escherichia coli., Microbiologyopen 1(4):381-94

 [16] Amores GR., de Las Heras A., Sanches-Medeiros A., Elfick A., Silva-Rocha R., 2017, Systematic identification of novel regulatory interactions controlling biofilm formation in the bacterium Escherichia coli., Sci Rep 7(1):16768

 [17] Zheng D., Constantinidou C., Hobman JL., Minchin SD., 2004, Identification of the CRP regulon using in vitro and in vivo transcriptional profiling., Nucleic Acids Res 32(19):5874-93

 [18] Ogasawara H., Yamamoto K., Ishihama A., 2011, Role of the biofilm master regulator CsgD in cross-regulation between biofilm formation and flagellar synthesis., J Bacteriol 193(10):2587-97

 [19] Ogasawara H., Yamamoto K., Ishihama A., 2010, Regulatory role of MlrA in transcription activation of csgD, the master regulator of biofilm formation in Escherichia coli., FEMS Microbiol Lett 312(2):160-8

 [20] Jubelin G., Vianney A., Beloin C., Ghigo JM., Lazzaroni JC., Lejeune P., Dorel C., 2005, CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli., J Bacteriol 187(6):2038-49

 [21] Ogasawara H., Shinohara S., Yamamoto K., Ishihama A., 2012, Novel regulation targets of the metal-response BasS-BasR two-component system of Escherichia coli., Microbiology 158(Pt 6):1482-92

 [22] Soo VW., Wood TK., 2013, Antitoxin MqsA represses curli formation through the master biofilm regulator CsgD., Sci Rep 3:3186

 [23] Prigent-Combaret C., Brombacher E., Vidal O., Ambert A., Lejeune P., Landini P., Dorel C., 2001, Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene., J Bacteriol 183(24):7213-23

 [24] Ogasawara H., Ishizuka T., Yamaji K., Kato Y., Shimada T., Ishihama A., 2019, Regulatory role of pyruvate-sensing BtsSR in biofilm formation by Escherichia coli K-12., FEMS Microbiol Lett 366(24)

 [25] Vianney A., Jubelin G., Renault S., Dorel C., Lejeune P., Lazzaroni JC., 2005, Escherichia coli tol and rcs genes participate in the complex network affecting curli synthesis., Microbiology 151(Pt 7):2487-97

 [26] Dudin O., Geiselmann J., Ogasawara H., Ishihama A., Lacour S., 2014, Repression of flagellar genes in exponential phase by CsgD and CpxR, two crucial modulators of Escherichia coli biofilm formation., J Bacteriol 196(3):707-15

 [27] Azam MW., Zuberi A., Khan AU., 2020, bolA gene involved in curli amyloids and fimbriae production in E. coli: exploring pathways to inhibit biofilm and amyloid formation., J Biol Res (Thessalon) 27:10

 [28] Yamanaka K., Inouye M., 1997, Growth-phase-dependent expression of cspD, encoding a member of the CspA family in Escherichia coli., J Bacteriol 179(16):5126-30
