RegulonDB RegulonDB 10.8: Operon Form
   

clpB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: clpB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: clpB
Gene(s): clpB   Genome Browser M3D Gene expression COLOMBOS
Note(s): Based on ChIP-chip and consensus sequences (Virtual Footprint), a site of NsrR negatively controlling the clpB gene has been identified Partridge JD,2009 However, this site is far from the clpB promoter, at -2674 bp from the TSS.
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Kitagawa M., et al., 1991
[2] Squires CL., et al., 1991
Promoter
Name: clpBp
+1: 2734205
Sigma Factor: Sigma32, Sigma70
Distance from start of the gene: 32
Sequence: ttttcacattaatctggtcaataaccttgaataattgagggatgacctcatttaatctccAgtagcaactttgatccgtta
                           -35                       -10    +1                   
Evidence: [AIPP]
[CV(RS-EPT-CBR)]
[CV(TIM)]
[HIPP]
[IDA]
[IEP]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Kitagawa M., et al., 1991
[3] Nonaka G., et al., 2006
[4] Salgado H, et al., 2012
[2] Squires CL., et al., 1991
[5] Wade JT., et al., 2006
Terminator(s)
Type: rho-independent
Sequence: ttttccgtctAACTTATAGACAAAAACGAGCCCCGAAGGGCTCGTTTTATCATTTACTGGACGGCgacaatccgg
Reference(s): [6] Feng CQ., et al., 2019
[7] Lesnik EA., et al., 2001


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  ryfD antisense post-transcriptional regulation repressor 2734156 2734178 GAGTTATGCGTCTGGATCGTCT [HIFS] [8]
  gcvB unknown unknown activator       [IMP] [9]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"




Reference(s)    

 [1] Kitagawa M., Wada C., Yoshioka S., Yura T., 1991, Expression of ClpB, an analog of the ATP-dependent protease regulatory subunit in Escherichia coli, is controlled by a heat shock sigma factor (sigma 32)., J Bacteriol 173(14):4247-53

 [2] Squires CL., Pedersen S., Ross BM., Squires C., 1991, ClpB is the Escherichia coli heat shock protein F84.1., J Bacteriol 173(14):4254-62

 [3] Nonaka G., Blankschien M., Herman C., Gross CA., Rhodius VA., 2006, Regulon and promoter analysis of the E. coli heat-shock factor, sigma32, reveals a multifaceted cellular response to heat stress., Genes Dev 20(13):1776-89

 [4] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [5] Wade JT., Roa DC., Grainger DC., Hurd D., Busby SJ., Struhl K., Nudler E., 2006, Extensive functional overlap between sigma factors in Escherichia coli., Nat Struct Mol Biol 13(9):806-14

 [6] Feng CQ., Zhang ZY., Zhu XJ., Lin Y., Chen W., Tang H., Lin H., 2019, iTerm-PseKNC: a sequence-based tool for predicting bacterial transcriptional terminators., Bioinformatics 35(9):1469-1477

 [7] Lesnik EA., Sampath R., Levene HB., Henderson TJ., McNeil JA., Ecker DJ., 2001, Prediction of rho-independent transcriptional terminators in Escherichia coli., Nucleic Acids Res 29(17):3583-94

 [8] Kawano M., Reynolds AA., Miranda-Rios J., Storz G., 2005, Detection of 5'- and 3'-UTR-derived small RNAs and cis-encoded antisense RNAs in Escherichia coli., Nucleic Acids Res 33(3):1040-50

 [9] Pulvermacher SC., Stauffer LT., Stauffer GV., 2009, Role of the sRNA GcvB in regulation of cycA in Escherichia coli., Microbiology 155(Pt 1):106-14


RegulonDB