RegulonDB RegulonDB 11.1: Operon Form
   

nuoABCEFGHIJKLMN operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: nuoABCEFGHIJKLMN
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: nuoABCEFGHIJKLMN
Synonym(s): nuo1-14
Gene(s): nuoN, nuoM, nuoL, nuoK, nuoJ, nuoI, nuoH, nuoG, nuoF, nuoE, nuoC, nuoB, nuoA   Genome Browser M3D Gene expression COLOMBOS
Note(s): Computer analysis revealed one inverted repeat upstream of nuoM that could form a stable stem-and-loop structure. It may serve as a signal of transcription regulation, causing RNA polymerase pausing. Each insertion used to construct a nuo mutant (nuoB-C, nuoF, nuoG, nuoH, nuoI, nuoM, and nuoN) exerted a polar effect upon dowstream transcription. With the exception of nuoB, this mutant synthesized detectable levels of the NuoCD subunit but did not synthesize any NuoG subunit. NuoG affects the promoter activity of this operon, although it is not known whether the effect of NuoG on the promoter is a direct one.

The nuo operon is regulated by O2 and nitrate via ArcA, NarL, FNR, and IHF. The main effect is an anaerobic repression by ArcA and nitrate stimulation by NarL.
Under nitrogen-rich growth conditions, the expression of the nuoA gene increased in a mutant for the transcriptional regulator Fnr. However, under nitrogen-limited growth conditions, the gene expression was decreased. Under both nitrogen-limited and nitrogen-rich growth conditions, the expression of nuoA increased in the mutants for cyoA and Fur. However, it is unknown if the effects of the transcriptional regulators act directly on the gene expression; also, it is unknown which of the two promoters that transcribe the gene could be regulated by the regulators Kumar R,2011
The expression of the gene nuoA is increased under acidic growth conditions in microaerobiosis Marzan LW,2013 nuoABC, among other genes involved in carbon source transport and metabolism, were downregulated in two MG1655 lysogens carrying closely related Stx2a phages O104 and PA8 1208335|.
CpxR represses transcription of the nuo and cyo operons in enteropathogenic Escherichia coli (EPEC), and these complexes confer adaptation to stresses that compromise envelope integrity. CpxR does not repress nuo transcription through steric hindrance of RNA polymerase Guest RL, Wang J, Wong JL, Raivio TL,2017 On the other hand, overproduction of NlpE downregulated nuo transcription in a CpxRA-dependent manner Guest RL, Wang J, Wong JL, Raivio TL,2017
Two putative binding sites were found -104 bp upstream and 48 bp downstream of the nuoA transcription start site that were required for repression of nuo-lux expression upon activation of the Cpx response Guest RL, Wang J, Wong JL, Raivio TL,2017 Based on site mutation and gene expression analyses, the functionality of these sites was demonstrated in mid-log-phase cells respiring in terrific broth conditions Guest RL, Wang J, Wong JL, Raivio TL,2017 Further, it is possible that an interaction between CpxR proteins bound separately at the proximal and distal binding sites prevents nuo transcription initiation through a looping mechanism Browning DF, Busby SJ,2004
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for nuoA and nuoB . This structure could regulate the expression of the genes, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s): [1] Archer CD., et al., 1995
[2] Leif H., et al., 1995
Promoter
Name: nuoAp2
+1: 2405162
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 90
Sequence: atagaaaggagtaaaaaaccacatcaattagctgtataaaagaatttctacagtgattgtAaggttttttttattcctccc
                                 -35                  -10   +1                   
Evidence: [COMP-AINF]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [3] Bongaerts J., et al., 1995
[4] Huerta AM., et al., 2003
[5] Weidner U., et al., 1993
Terminator(s)
Type: rho-independent
Sequence: ttcagaaaaaCCGCCGAGCATGTCGGCGGctttctgact
Reference(s): [5] Weidner U., et al., 1993
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote ArcA-phosphorylated repressor nuoAp2 2405263 2405277 -108.0 tgctaatggtGTTGATATTATGTAAactaatgtga nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION] W [7], [8], [9]
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR repressor nuoAp2 2405196 2405209 -40.5 gaaaggagtaAAAAACCACATCAAttagctgtat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS], [EXP-IMP-SITE-MUTATION] W [11], [12]
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF repressor nuoAp2 2405222 2405234 -66.0 ttgttaaagtTGACAAAAGGTTAtagaaaggag nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3], [10]
proximal IHF repressor nuoAp2 2405230 2405242 -74.0 agaaacttttGTTAAAGTTGACAaaaggttata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3], [10]
proximal IHF repressor nuoAp2 2405239 2405251 -83.0 ctaatgtgaaGAAACTTTTGTTAaagttgacaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [3], [10]
[NarL,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NarL-phosphorylated activator nuoAp2 2405281 2405287 -122.0 gggcattaaaTGCTAATggtgttgata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W nd
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB nuoABCEFGHIJKLMN repressor 2405062 2405085 GACAUACUCAUUGCUUACUCAUCA nd [EXP-IMP-SITE-MUTATION] [6]


Transcription unit          
Name: nuoABCEFGHIJKLMN
Synonym(s): nuo1-14
Gene(s): nuoN, nuoM, nuoL, nuoK, nuoJ, nuoI, nuoH, nuoG, nuoF, nuoE, nuoC, nuoB, nuoA   Genome Browser M3D Gene expression COLOMBOS
Note(s): Computer analysis revealed one inverted repeat upstream of nuoM that could form a stable stem-and-loop structure. It may serve as a signal of transcription regulation, causing RNA polymerase pausing. Each insertion used to construct a nuo mutant (nuoB-C, nuoF, nuoG, nuoH, nuoI, nuoM, and nuoN) exerted a polar effect upon dowstream transcription. With the exception of nuoB, this mutant synthesized detectable levels of the NuoCD subunit but did not synthesize any NuoG subunit. NuoG affects the promoter activity of this operon, although it is not known whether the effect of NuoG on the promoter is a direct one.
Under nitrogen-rich growth conditions, the expression of the nuoA gene increased in a mutant for the transcriptional regulator Fnr. However, under nitrogen-limited growth conditions, the gene expression was decreased. Under both nitrogen-limited and nitrogen-rich growth conditions, the expression of nuoA increased in the mutants for cyoA and Fur. However, it is unknown if the effects of the transcriptional regulators act directly on the gene expression; also, it is unknown which of the two promoters that transcribe the gene could be regulated by the regulators Kumar R,2011
The expression of the gene nuoA is increased under acidic growth conditions in microaerobiosis Marzan LW,2013 nuoABC, among other genes involved in carbon source transport and metabolism, were downregulated in two MG1655 lysogens carrying closely related Stx2a phages O104 and PA8 1208335|.
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for nuoA and nuoB. This structure could regulate the expression of the genes, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s): [3] Bongaerts J., et al., 1995
[13] Falk-Krzesinski HJ., et al., 1998
[5] Weidner U., et al., 1993
Promoter
Name: nuoAp1
+1: 2405335
Distance from start of the gene: 263
Sequence: tcctgtcaaaatagacccgtattttttccattgcttcacaacggacacgattcaacaacaTctaattatcctggagtcgtc
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [3] Bongaerts J., et al., 1995
Terminator(s)
Type: rho-independent
Sequence: ttcagaaaaaCCGCCGAGCATGTCGGCGGctttctgact
Reference(s): [5] Weidner U., et al., 1993
TF binding sites (TFBSs)
[Fis,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis activator nuoAp1 2405466 2405480 -138.5 acgtaaatttGTTGCTGCGTTTTTGttatggaatg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10], [14]
remote Fis activator nuoAp1 2405526 2405540 -198.5 gtcccgaacgCACAAATAATCGCCTgaaaaaaatc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10], [14]
remote Fis activator nuoAp1 2405563 2405577 -235.5 tacaaaactgTTCATTTTTCAACCAccagagattc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10], [14]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RyhB nuoABCEFGHIJKLMN repressor 2405062 2405085 GACAUACUCAUUGCUUACUCAUCA nd [EXP-IMP-SITE-MUTATION] [6]


Transcription unit       
Name: nuoMN
Gene(s): nuoN, nuoM   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
[IC-ADJ-GENES-SAME-BIO-PROCESS] Products of adjacent genes in the same biological process
Reference(s): [15] Zaslaver A., et al., 2006
Promoter
Name: nuoMp
+1: Unknown
Note(s): Zaslaver et al. demonstrated in 2006, by means of a library of fluorescent transcription fusions, that this promoter can be transcribed in vitro Zaslaver A,2006. Based on this, a putative promoter was suggested, but the +1 site of the transcription initiation has not been determined, although there exists promoter activity.
Evidence: [EXP-IEP]
Reference(s): [15] Zaslaver A., et al., 2006
Terminator(s)
Type: rho-independent
Sequence: ttcagaaaaaCCGCCGAGCATGTCGGCGGctttctgact
Reference(s): [5] Weidner U., et al., 1993


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [EXP-IDA-BINDING-OF-CELLULAR-EXTRACTS] Binding of cellular extracts

 [EXP-IMP-SITE-MUTATION] Site mutation

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP] Inferred from expression pattern


Reference(s)    

 [1] Archer CD., Elliott T., 1995, Transcriptional control of the nuo operon which encodes the energy-conserving NADH dehydrogenase of Salmonella typhimurium., J Bacteriol 177(9):2335-42

 [2] Leif H., Sled VD., Ohnishi T., Weiss H., Friedrich T., 1995, Isolation and characterization of the proton-translocating NADH: ubiquinone oxidoreductase from Escherichia coli., Eur J Biochem 230(2):538-48

 [3] Bongaerts J., Zoske S., Weidner U., Unden G., 1995, Transcriptional regulation of the proton translocating NADH dehydrogenase genes (nuoA-N) of Escherichia coli by electron acceptors, electron donors and gene regulators., Mol Microbiol 16(3):521-34

 [4] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [5] Weidner U., Geier S., Ptock A., Friedrich T., Leif H., Weiss H., 1993, The gene locus of the proton-translocating NADH: ubiquinone oxidoreductase in Escherichia coli. Organization of the 14 genes and relationship between the derived proteins and subunits of mitochondrial complex I., J Mol Biol 233(1):109-22

 [6] Chareyre S., Barras F., Mandin P., 2019, A small RNA controls bacterial sensitivity to gentamicin during iron starvation., PLoS Genet 15(4):e1008078

 [7] Lynch AS., Lin EC., 1996, Transcriptional control mediated by the ArcA two-component response regulator protein of Escherichia coli: characterization of DNA binding at target promoters., J Bacteriol 178(21):6238-49

 [8] Salmon KA., Hung SP., Steffen NR., Krupp R., Baldi P., Hatfield GW., Gunsalus RP., 2005, Global gene expression profiling in Escherichia coli K12: effects of oxygen availability and ArcA., J Biol Chem 280(15):15084-96

 [9] Shalel-Levanon S., San KY., Bennett GN., 2005, Effect of oxygen, and ArcA and FNR regulators on the expression of genes related to the electron transfer chain and the TCA cycle in Escherichia coli., Metab Eng 7(5-6):364-74

 [10] Wackwitz B., Bongaerts J., Goodman SD., Unden G., 1999, Growth phase-dependent regulation of nuoA-N expression in Escherichia coli K-12 by the Fis protein: upstream binding sites and bioenergetic significance., Mol Gen Genet 262(4-5):876-83

 [11] Kumar R., Shimizu K., 2011, Transcriptional regulation of main metabolic pathways of cyoA, cydB, fnr, and fur gene knockout Escherichia coli in C-limited and N-limited aerobic continuous cultures., Microb Cell Fact 10:3

 [12] Salmon K., Hung SP., Mekjian K., Baldi P., Hatfield GW., Gunsalus RP., 2003, Global gene expression profiling in Escherichia coli K12. The effects of oxygen availability and FNR., J Biol Chem 278(32):29837-55

 [13] Falk-Krzesinski HJ., Wolfe AJ., 1998, Genetic analysis of the nuo locus, which encodes the proton-translocating NADH dehydrogenase in Escherichia coli., J Bacteriol 180(5):1174-84

 [14] Zhang J., Zeuner Y., Kleefeld A., Unden G., Janshoff A., 2004, Multiple site-specific binding of Fis protein to Escherichia coli nuoA-N promoter DNA and its impact on DNA topology visualised by means of scanning force microscopy., Chembiochem 5(9):1286-9

 [15] Zaslaver A., Bren A., Ronen M., Itzkovitz S., Kikoin I., Shavit S., Liebermeister W., Surette MG., Alon U., 2006, A comprehensive library of fluorescent transcriptional reporters for Escherichia coli., Nat Methods 3(8):623-8

RegulonDB