RegulonDB RegulonDB 10.10: Operon Form

tsx operon and associated TUs in Escherichia coli K-12 genome

Name: tsx
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: tsx
Gene(s): tsx   Genome Browser M3D Gene expression COLOMBOS
Note(s): Gavigan et al. (1999) and Perini et al. (1996) showed that CytR binds in tandem in the regulated intergenic region Gavigan SA,1999. Perini LT,1996 On the other hand, in 1997, Pedersen and Valentin-Hanses showed that CytR binds to octamer repeats, GTTGCATT in either the direct or inverted orientation and preferably separated by 2 or 3 bp Pedersen H,1997. Jorgensen CI,1998. For this reason the length of the CytR DNA-binding site is variable.
However, footprinting analyses showed that the dimers of CytR are flanked or sandwiched by two dimers of CRP Gerlach P,1991 Thus, the binding sites of CytR located in this region were assigned by the curator in agreement based on similarity to the consensus sequence and on the data from the footprinting assays and mutational evidence Gerlach P,1991. Holst B,1992. Holt AK,2010. Pedersen H,1997. Sogaard-Andersen L,1990. Zolotukhina MA,2002
The repressor CytR and the activator CRP, two dimeric proteins, interact to form a complex repressor nucleoprotein in the intergenic region. When only CRP is bound to this promoter, it functions as an activator, and then, when CytR binds to DNA and to CRP, the activation is repressed because CytR masks an activating region of CRP that otherwise would contact the RNA polymerase to activate transcription Valentin-Hansen P, Søgaard-Andersen L, Pedersen H,1996. Meibom KL, Kallipolitis BH, Ebright RH, Valentin-Hansen P,2000 The CytR protein cannot act alone; the synergistic DNA binding is increased by direct interaction with CRP Sogaard-Andersen L,1990. Sogaard-Andersen L,1990. Sogaard-Andersen L,1991 At times CytR also repositions CRP to alternative DNA-binding sites that are not functional for activation Valentin-Hansen P, Søgaard-Andersen L, Pedersen H,1996
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Bremer E., et al., 1990
Name: tsxp2
+1: 432091
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 78
Sequence: aaatgatagaactgtgaaacgaaacatatttttgtgagcaatgatttttataataggctcCtctgtatacgaaatatttag
                          -35                    -10        +1                   
Evidence: [HIPP]
Reference(s): [1] Bremer E., et al., 1990
[2] Gerlach P., et al., 1991
[3] Huerta AM., et al., 2003
Type: rho-independent
Sequence: taacaatcagAAATGCCGGGAATAAATCCCGGCATTTtcataatcag
Reference(s): [1] Bremer E., et al., 1990
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator tsxp2 432121 432142 -40.5 taaatgatagAACTGTGAAACGAAACATATTTttgtgagcaa nd [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [2], [6], [7]
proximal CRP-cyclic-AMP activator tsxp2 432154 432176 -73.5 cgaatgtgtgTAAACGTGAACGCAATCGATTACgtaaatgata nd [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] [2], [6], [7]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP repressor tsxp2 432121 432142 -40.5 taaatgatagAACTGTGAAACGAAACATATTTttgtgagcaa nd [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [2], [6], [7]
proximal CRP-cyclic-AMP repressor tsxp2 432154 432176 -73.5 cgaatgtgtgTAAACGTGAACGCAATCGATTACgtaaatgata nd [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] [2], [6], [7]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CytR repressor tsxp2 432110 432136 -31.5 atagaactgtGAAACGAAACATATTTTTGTGAGCAATgatttttata nd [GEA], [IC], [BPP], [IC], [SM] [2]
proximal CytR repressor tsxp2 432140 432158 -57.5 aacgcaatcgATTACGTAAATGATAGAACtgtgaaacga nd [GEA], [IC], [BPP], [IC], [IHBCE] [2], [6]
proximal CytR repressor tsxp2 432150 432170 -68.5 tgtgtaaacgTGAACGCAATCGATTACGTAAatgatagaac nd [GEA], [IC], [APIORCISFBSCS], [BPP], [IC], [SM] [2]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA tsx repressor 432049 432071 GAAAAAGGCGCAAAUUGCGUUUC nd [IEP], [SM] [4]
small regulatory RNA RybB tsx repressor 432020 432038 GCCACUGUUUGAAAAUCCC nd [IEP], [IPI] [4], [5]

Transcription unit          
Name: tsx
Gene(s): tsx   Genome Browser M3D Gene expression COLOMBOS
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Bremer E., et al., 1990
Name: tsxp1
+1: 432245
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 232
Sequence: ttcgggacgattttgtgcgtcccgcaacatctttccccgtcattttgttactctgcttacAtcacctggattgatagtaaa
                       -35                       -10        +1                   
Evidence: [HIPP]
Reference(s): [1] Bremer E., et al., 1990
[3] Huerta AM., et al., 2003
Type: rho-independent
Sequence: taacaatcagAAATGCCGGGAATAAATCCCGGCATTTtcataatcag
Reference(s): [1] Bremer E., et al., 1990
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal DeoR repressor tsxp1 432245 432260 -7.5 cccgtcatttTGTTACTCTGCTTACAtcacctggat nd [GEA], [BCE] [6]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA tsx repressor 432049 432071 GAAAAAGGCGCAAAUUGCGUUUC nd [IEP], [SM] [4]
small regulatory RNA RybB tsx repressor 432020 432038 GCCACUGUUUGAAAAUCCC nd [IEP], [IPI] [4], [5]


 [1] Bremer E., Middendorf A., Martinussen J., Valentin-Hansen P., 1990, Analysis of the tsx gene, which encodes a nucleoside-specific channel-forming protein (Tsx) in the outer membrane of Escherichia coli., Gene 96(1):59-65

 [2] Gerlach P., Sogaard-Andersen L., Pedersen H., Martinussen J., Valentin-Hansen P., Bremer E., 1991, The cyclic AMP (cAMP)-cAMP receptor protein complex functions both as an activator and as a corepressor at the tsx-p2 promoter of Escherichia coli K-12., J Bacteriol 173(17):5419-30

 [3] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [4] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [5] Lalaouna D., Carrier MC., Semsey S., Brouard JS., Wang J., Wade JT., Masse E., 2015, A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise., Mol Cell 58(3):393-405

 [6] Bremer E., Gerlach P., Middendorf A., 1988, Double negative and positive control of tsx expression in Escherichia coli., J Bacteriol 170(1):108-16

 [7] Zheng D., Constantinidou C., Hobman JL., Minchin SD., 2004, Identification of the CRP regulon using in vitro and in vivo transcriptional profiling., Nucleic Acids Res 32(19):5874-93
