RegulonDB RegulonDB 10.8: Operon Form

envY-ompT operon and associated TUs in Escherichia coli K-12 genome

Name: envY-ompT
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: ompT
Gene(s): ompT   Genome Browser M3D Gene expression COLOMBOS
Name: ompTp
+1: 585665
Distance from start of the gene: 32
Sequence: atataaacagtggagcaatatgtaattgactcattaagttagatataaaaaatacatattCaatcattaaaacgattgaat
Evidence: [CV(RS-EPT-CBR)]
Reference(s): [1] Eguchi Y., et al., 2004
[2] Salgado H, et al., 2012
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoP-Phosphorylated activator ompTp 585706 585722 -49.0 aaacaaaataTAAACAGTGGAGCAATAtgtaattgac nd [APIORCISFBSCS], [CV(GEA)], [GEA] [3], [4]

Transcription unit       

Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  omrB antisense post-transcriptional regulation repressor 585614 585645 TGGAGAACTTTTATGCGGGCGAAACTTCTGG [IMP] [7]
  omrA antisense post-transcriptional regulation repressor 585614 585645 TGGAGAACTTTTATGCGGGCGAAACTTCTGG [IMP] [7]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


 [1] Eguchi Y., Okada T., Minagawa S., Oshima T., Mori H., Yamamoto K., Ishihama A., Utsumi R., 2004, Signal transduction cascade between EvgA/EvgS and PhoP/PhoQ two-component systems of Escherichia coli., J Bacteriol 186(10):3006-14

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Minagawa S., Ogasawara H., Kato A., Yamamoto K., Eguchi Y., Oshima T., Mori H., Ishihama A., Utsumi R., 2003, Identification and molecular characterization of the Mg2+ stimulon of Escherichia coli., J Bacteriol 185(13):3696-702

 [4] Zwir I., Shin D., Kato A., Nishino K., Latifi T., Solomon F., Hare JM., Huang H., Groisman EA., 2005, Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica., Proc Natl Acad Sci U S A 102(8):2862-7

 [5] Blattner FR., Plunkett G., Bloch CA., Perna NT., Burland V., Riley M., Collado-Vides J., Glasner JD., Rode CK., Mayhew GF., Gregor J., Davis NW., Kirkpatrick HA., Goeden MA., Rose DJ., Mau B., Shao Y., 1997, The complete genome sequence of Escherichia coli K-12., Science 277(5331):1453-74

 [6] Lundrigan MD., Earhart CF., 1984, Gene envY of Escherichia coli K-12 affects thermoregulation of major porin expression., J Bacteriol 157(1):262-8

 [7] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47
