RegulonDB RegulonDB 10.8: Operon Form
   

cirA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: cirA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: cirA
Synonym(s): OP00019, cir
Gene(s): cirA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [BTEI] Boundaries of transcription experimentally identified
[PM] Polar mutation
Reference(s): [1] Griggs DW., et al., 1987
Promoter
Name: cirAp1
+1: 2246929
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 160
Sequence: ggatataaaatttaacatttggattgataattgttatcgtttgcattatcgttacgccgcAatcaaaaaaggctgacaaat
                        -35                    -10          +1                   
Evidence: [HIPP]
[TIM]
Reference(s): [1] Griggs DW., et al., 1987
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd CRP-cAMP activator cirAp1 nd nd nd nd nd [APIORCISFBSCS], [CV(GEA)], [GEA] [7]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fur-Fe2+ repressor cirAp1 2246937 2246955 -17.0 tgataattgtTATCGTTTGCATTATCGTTacgccgcaat nd [AIBSCS], [CV(GEA)], [GEA] [4], [5], [6]
proximal Fur-Fe2+ repressor cirAp1 2246943 2246961 -23.0 ttggattgatAATTGTTATCGTTTGCATTatcgttacgc nd [APIORCISFBSCS], [BCE] [2]
proximal Fur-Fe2+ repressor cirAp1 2246949 2246967 -29.0 taacatttggATTGATAATTGTTATCGTTtgcattatcg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2], [3], [4], [5]
proximal Fur-Fe2+ repressor cirAp1 2246955 2246973 -35.0 aaaatttaacATTTGGATTGATAATTGTTatcgtttgca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2], [3], [4], [5]


Transcription unit          
Name: cirA
Synonym(s): OP00019
Gene(s): cirA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [BTEI] Boundaries of transcription experimentally identified
[PM] Polar mutation
Reference(s): [1] Griggs DW., et al., 1987
Promoter
Name: cirAp2
+1: 2246942
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 173
Sequence: tgacaaatcatgcggatataaaatttaacatttggattgataattgttatcgtttgcattAtcgttacgccgcaatcaaaa
                         -35                    -10         +1                   
Evidence: [TIM]
Reference(s): [1] Griggs DW., et al., 1987
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd CRP-cAMP activator cirAp2 nd nd nd nd nd nd [7]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fur-Fe2+ repressor cirAp2 2246937 2246955 -4.0 tgataattgtTATCGTTTGCATTATCGTTacgccgcaat nd [AIBSCS], [CV(GEA)], [GEA] [4], [5], [6]
proximal Fur-Fe2+ repressor cirAp2 2246949 2246967 -16.0 taacatttggATTGATAATTGTTATCGTTtgcattatcg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2], [3], [4], [5]
proximal Fur-Fe2+ repressor cirAp2 2246955 2246973 -22.0 aaaatttaacATTTGGATTGATAATTGTTatcgtttgca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2], [3], [4], [5]


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  omrA antisense post-transcriptional regulation repressor 2246779 2246804 ATTTTATTTTCGTAGTTACCTCATG [IMP] [8]
  omrB antisense post-transcriptional regulation repressor 2246779 2246804 ATTTTATTTTCGTAGTTACCTCATG [IMP] [8]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


Evidence    

 [HIPP] Human inference of promoter position

 [TIM] Transcription initiation mapping

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [CV(GEA)] cross validation(GEA)

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [BCE] Binding of cellular extracts

 [BPP] Binding of purified proteins


Reference(s)    

 [1] Griggs DW., Tharp BB., Konisky J., 1987, Cloning and promoter identification of the iron-regulated cir gene of Escherichia coli., J Bacteriol 169(12):5343-52

 [2] Chen Z., Lewis KA., Shultzaberger RK., Lyakhov IG., Zheng M., Doan B., Storz G., Schneider TD., 2007, Discovery of Fur binding site clusters in Escherichia coli by information theory models., Nucleic Acids Res 35(20):6762-77

 [3] Griggs DW., Konisky J., 1989, Mechanism for iron-regulated transcription of the Escherichia coli cir gene: metal-dependent binding of fur protein to the promoters., J Bacteriol 171(2):1048-54

 [4] Vassinova N., Kozyrev D., 2000, A method for direct cloning of fur-regulated genes: identification of seven new fur-regulated loci in Escherichia coli., Microbiology 146 Pt 12:3171-3182

 [5] White-Ziegler CA., Malhowski AJ., Young S., 2007, Human body temperature (37degrees C) increases the expression of iron, carbohydrate, and amino acid utilization genes in Escherichia coli K-12., J Bacteriol 189(15):5429-40

 [6] Newman DL., Shapiro JA., 1999, Differential fiu-lacZ fusion regulation linked to Escherichia coli colony development., Mol Microbiol 33(1):18-32

 [7] Griggs DW., Kafka K., Nau CD., Konisky J., 1990, Activation of expression of the Escherichia coli cir gene by an iron-independent regulatory mechanism involving cyclic AMP-cyclic AMP receptor protein complex., J Bacteriol 172(6):3529-33

 [8] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47

RegulonDB