![]() ![]() ![]() ![]() |
Name: | cirA |
Synonym(s): | OP00019, cir |
Gene(s): | cirA Genome Browser M3D Gene expression COLOMBOS |
Evidence: | [BTEI] Boundaries of transcription experimentally identified [PM] Polar mutation |
Reference(s): | [1] Griggs DW., et al., 1987 |
Promoter | |
Name: | cirAp1 |
+1: | 2246929 |
Sigma Factor: | Sigma70 Sigmulon |
Distance from start of the gene: | 160 |
Sequence: |
ggatataaaatttaacatttggattgataattgttatcgtttgcattatcgttacgccgcAatcaaaaaaggctgacaaat -35 -10 +1 |
Evidence: |
[HIPP] [TIM] |
Reference(s): | [1] Griggs DW., et al., 1987 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246937 | 2246955 | -17.0 | tgataattgtTATCGTTTGCATTATCGTTacgccgcaat | nd | [AIBSCS], [CV(GEA)], [GEA] | [4], [5], [6] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246943 | 2246961 | -23.0 | ttggattgatAATTGTTATCGTTTGCATTatcgttacgc | nd | [APIORCISFBSCS], [BCE] | [2] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246949 | 2246967 | -29.0 | taacatttggATTGATAATTGTTATCGTTtgcattatcg | nd | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [2], [3], [4], [5] |
proximal | Fur-Fe2+ | repressor | cirAp1 | 2246955 | 2246973 | -35.0 | aaaatttaacATTTGGATTGATAATTGTTatcgtttgca | nd | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [2], [3], [4], [5] |
Name: | cirA |
Synonym(s): | OP00019 |
Gene(s): | cirA Genome Browser M3D Gene expression COLOMBOS |
Evidence: | [BTEI] Boundaries of transcription experimentally identified [PM] Polar mutation |
Reference(s): | [1] Griggs DW., et al., 1987 |
Promoter | |
Name: | cirAp2 |
+1: | 2246942 |
Sigma Factor: | Sigma70 Sigmulon |
Distance from start of the gene: | 173 |
Sequence: |
tgacaaatcatgcggatataaaatttaacatttggattgataattgttatcgtttgcattAtcgttacgccgcaatcaaaa -35 -10 +1 |
Evidence: | [TIM] |
Reference(s): | [1] Griggs DW., et al., 1987 |
Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
---|---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246937 | 2246955 | -4.0 | tgataattgtTATCGTTTGCATTATCGTTacgccgcaat | nd | [AIBSCS], [CV(GEA)], [GEA] | [4], [5], [6] |
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246949 | 2246967 | -16.0 | taacatttggATTGATAATTGTTATCGTTtgcattatcg | nd | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [2], [3], [4], [5] |
proximal | Fur-Fe2+ | repressor | cirAp2 | 2246955 | 2246973 | -22.0 | aaaatttaacATTTGGATTGATAATTGTTatcgtttgca | nd | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [2], [3], [4], [5] |
Regulation by sRNA | ![]() |
---|
Small RNA name (Regulator) | Regulation type | Mechanism | Function | Binding Sites | Evidence | Reference | |||
---|---|---|---|---|---|---|---|---|---|
LeftPos | RightPos | Sequence (RNA-strand) | |||||||
omrA | antisense | post-transcriptional regulation | repressor | 2246779 | 2246804 | ATTTTATTTTCGTAGTTACCTCATG | [IMP] | [8] | |
omrB | antisense | post-transcriptional regulation | repressor | 2246779 | 2246804 | ATTTTATTTTCGTAGTTACCTCATG | [IMP] | [8] |
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'" |
Reference(s) |
![]() |
---|---|