RegulonDB RegulonDB 10.8: Operon Form
   

galETKM operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: galETKM
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: galK
Gene(s): galK   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Lee HJ., et al., 2008
Promoter
Name: galKp
+1: 790463
Distance from start of the gene: 484
Sequence: ttgggcaaatagcttcctgcctaacgaagctgagcgcgaagaccgcctgcaaaaagaataTtttgccgaacagaaatcacc
Evidence: [TIM]
Reference(s): [1] Lee HJ., et al., 2008


Transcription unit          
Name: galE
Gene(s): galE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Lee HJ., et al., 2008
[2] Wang X., et al., 2014
Promoter
Name: galEp1
+1: 792081
Sigma Factor: Sigma70, Sigma38
Distance from start of the gene: 26
Sequence: gattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttatttcAtaccataagcctaatggagc
                    -35                     -10             +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
galEp1 is the main promoter during the exponential growth phase, since it produces 70% of total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
This promoter has an extended -10 region.
GalR, which mediates formation of the DNA loop on galEp1, was less efficient in repressing galEp1 transcription when RNA polymerase was bound to the -10 and -35 elements concomitantly 22941635 Promoters that lack specific -35 element recognition allow decoupling of local chromosome structure from transcription initiation 22941635
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [3] Colland F., et al., 1999
[4] Musso RE., et al., 1974
[5] Sur R., et al., 2001
[6] Tanaka K., et al., 1995
Terminator(s)
Type: rho-dependent
Sequence: aagtcccggtGTAATCGGGGTTTTTATCGCCTGTCACCCGCACATTACCTGCGCAGAGGAAGCAATCTGGATCGTGCGCAGGTAACACCTGTTTGGCTGGCGTTTCCTGCGCCCCCTGCCAGGGGCGCTTAGCGCGGTGCGGTGAAACCAgaatccattg
Reference(s): [1] Lee HJ., et al., 2008
Type: rho-dependent
Sequence: cgtaaaacgtGGGCTTTGGGCAGCAGTAGCGTTTCGAACGGCCAGGCAGCCCAGTAAGGCACGACGGCTAACCAGTGTTCGGTTTCGACAACGGTACGGCTACCGTCTGCCAGCTCGCGCTGAAcataatccac
Reference(s): [1] Lee HJ., et al., 2008
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP activator galEp1 792112 792133 -41.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp1 792028 792043 46.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp1 792022 792037 52.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS repressor galEp1 792076 792090 -2.0 gttatgctatGGTTATTTCATACCAtaagcctaat nd [BPP] [20]
proximal H-NS repressor galEp1 792092 792106 -18.0 cacttttcgcATCTTTGTTATGCTAtggttatttc nd [BPP] [20]
proximal H-NS repressor galEp1 792110 792124 -36.0 ctaatttattCCATGTCACACTTTTcgcatctttg nd [BPP] [20]
proximal H-NS repressor galEp1 792121 792135 -47.0 aaacgattccACTAATTTATTCCATgtcacacttt nd [BPP] [20]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp1 792059 792092 6.5 ttgttatgctATGGTTATTTCATACCATAAGCCTAATGGAGCGAattatgagag nd [BPP], [GEA] [14], [15], [17], [18], [24], [25], [26]
Note(s): 1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.1GalR is required to bind HU.2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
8GalR is required to bind HU.
9HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galETKM
Synonym(s): OP00032
Gene(s): galM, galK, galT, galE   Genome Browser M3D Gene expression COLOMBOS
Note(s): The famine-feast cycle of bacterial growth was simulated by Horvath et al. (2010) by diluting stationary-phase cells in fresh medium containing galactose as the sole carbon source. The results showed, via measurements of the proper timing of gene expression in the galactose system, that the system has evolved to respond to environments where galactose levels are unpredictable and do not follow regular feast-famine cycles 20923764
Based on these results, a mathematical model was built where the intracellular D-galactose and cAMP-CRP levels were calculated 20923764
Rob is a transcriptional regulator related to the increase in resistance to antibiotics and is expressed constitutively. Bennik et al. have shown that this regulator represses the transcription of the galT gene and that it forms multiple complexes in the promoter region, suggesting the existence of multiple Rob-binding sites Bennik MH,2000.
Based on the combination of the transcriptional network of the galactose regulon obtained from their experiments and data in the published literature, Semsey S,2007constructed an integrated map of the galactose network.
The galETKM operon has six different mRNA species (mE1, mE2, mT1, mK1, mM1, and mK2) Lee HJ,2008. Wang X,2014 The operon presents a gradient of gene expression known as natural polarity Lee HJ,2008. Wang X,2014 The transcription of the mRNA species is a principal mechanism in the generation of the gradient in gene expression from the promoter-proximal galE to the promoter-distal galM. Transcription initiation is tightly coupled to mRNA processing and/or transcription termination Lee HJ,2008 Expression of these six different mRNA species is regulated by transcription termination and generation of a galK-specific mRNA, mK2 Wang X,2014 galETKM, among other genes involved in carbon source transport and metabolism, were downregulated in two MG1655 lysogens carrying closely related Stx2a phages O104 and PA8 1208335|.
Review: 26501343.
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [28] Queen C., et al., 1981
[5] Sur R., et al., 2001
Promoter
Name: galEp1
+1: 792081
Sigma Factor: Sigma70, Sigma38
Distance from start of the gene: 26
Sequence: gattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttatttcAtaccataagcctaatggagc
                    -35                     -10             +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
galEp1 is the main promoter during the exponential growth phase, since it produces 70% of total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
This promoter has an extended -10 region.
GalR, which mediates formation of the DNA loop on galEp1, was less efficient in repressing galEp1 transcription when RNA polymerase was bound to the -10 and -35 elements concomitantly 22941635 Promoters that lack specific -35 element recognition allow decoupling of local chromosome structure from transcription initiation 22941635
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [3] Colland F., et al., 1999
[4] Musso RE., et al., 1974
[5] Sur R., et al., 2001
[6] Tanaka K., et al., 1995
Terminator(s)
Type: rho-dependent
Sequence: atttgaacaaTATGAGataaagccct
Reference(s): [1] Lee HJ., et al., 2008
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP activator galEp1 792112 792133 -41.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp1 792028 792043 46.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp1 792022 792037 52.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS repressor galEp1 792076 792090 -2.0 gttatgctatGGTTATTTCATACCAtaagcctaat nd [BPP] [20]
proximal H-NS repressor galEp1 792092 792106 -18.0 cacttttcgcATCTTTGTTATGCTAtggttatttc nd [BPP] [20]
proximal H-NS repressor galEp1 792110 792124 -36.0 ctaatttattCCATGTCACACTTTTcgcatctttg nd [BPP] [20]
proximal H-NS repressor galEp1 792121 792135 -47.0 aaacgattccACTAATTTATTCCATgtcacacttt nd [BPP] [20]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp1 792059 792092 6.5 ttgttatgctATGGTTATTTCATACCATAAGCCTAATGGAGCGAattatgagag nd [BPP], [GEA] [14], [15], [17], [18], [24], [25], [26]
Note(s): 1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.1GalR is required to bind HU.2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
8GalR is required to bind HU.
9HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galET
Gene(s): galT, galE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [29] Becker NA., et al., 2014
[1] Lee HJ., et al., 2008
Promoter
Name: galEp1
+1: 792081
Sigma Factor: Sigma70, Sigma38
Distance from start of the gene: 26
Sequence: gattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttatttcAtaccataagcctaatggagc
                    -35                     -10             +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
galEp1 is the main promoter during the exponential growth phase, since it produces 70% of total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
This promoter has an extended -10 region.
GalR, which mediates formation of the DNA loop on galEp1, was less efficient in repressing galEp1 transcription when RNA polymerase was bound to the -10 and -35 elements concomitantly 22941635 Promoters that lack specific -35 element recognition allow decoupling of local chromosome structure from transcription initiation 22941635
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [3] Colland F., et al., 1999
[4] Musso RE., et al., 1974
[5] Sur R., et al., 2001
[6] Tanaka K., et al., 1995
Terminator(s)
Type: rho-dependent
Sequence: ataatcaatcGCGCAGGGCAGAACGAAACCGTCGTTGTAGTCGGTGTGTTCACCAATCAAATTCACGCGGCCAGGCGCCTGAATGGTGTgagtggcagg
Reference(s): [1] Lee HJ., et al., 2008
Type: rho-dependent
Sequence: ttggcaaacaGAGATTGTGTTTTTTCTTTCAGACTCatttcttaca
Reference(s): [1] Lee HJ., et al., 2008
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP activator galEp1 792112 792133 -41.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp1 792028 792043 46.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp1 792022 792037 52.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS repressor galEp1 792076 792090 -2.0 gttatgctatGGTTATTTCATACCAtaagcctaat nd [BPP] [20]
proximal H-NS repressor galEp1 792092 792106 -18.0 cacttttcgcATCTTTGTTATGCTAtggttatttc nd [BPP] [20]
proximal H-NS repressor galEp1 792110 792124 -36.0 ctaatttattCCATGTCACACTTTTcgcatctttg nd [BPP] [20]
proximal H-NS repressor galEp1 792121 792135 -47.0 aaacgattccACTAATTTATTCCATgtcacacttt nd [BPP] [20]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp1 792059 792092 6.5 ttgttatgctATGGTTATTTCATACCATAAGCCTAATGGAGCGAattatgagag nd [BPP], [GEA] [14], [15], [17], [18], [24], [25], [26]
Note(s): 1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.1GalR is required to bind HU.2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
8GalR is required to bind HU.
9HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galETK
Gene(s): galK, galT, galE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Lee HJ., et al., 2008
[2] Wang X., et al., 2014
Promoter
Name: galEp1
+1: 792081
Sigma Factor: Sigma70, Sigma38
Distance from start of the gene: 26
Sequence: gattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttatttcAtaccataagcctaatggagc
                    -35                     -10             +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
galEp1 is the main promoter during the exponential growth phase, since it produces 70% of total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
This promoter has an extended -10 region.
GalR, which mediates formation of the DNA loop on galEp1, was less efficient in repressing galEp1 transcription when RNA polymerase was bound to the -10 and -35 elements concomitantly 22941635 Promoters that lack specific -35 element recognition allow decoupling of local chromosome structure from transcription initiation 22941635
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [3] Colland F., et al., 1999
[4] Musso RE., et al., 1974
[5] Sur R., et al., 2001
[6] Tanaka K., et al., 1995
Terminator(s)
Type: rho-dependent
Sequence: ttggcataacGACCAATAGAGGCCCCCAGAAACGCGGCCTGATCCTGATAGCATTCCGGGCTGGCACAGCCGAGCAGCGCCTCGCGGACGCTGCCATCGGAAAGCGGAATACGGGCGGAAAGTAAAGTCGCACCCCAgtccatcagc
Reference(s): [1] Lee HJ., et al., 2008
TF binding sites (TFBSs)
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP activator galEp1 792112 792133 -41.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp1 792028 792043 46.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp1 792022 792037 52.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp1 792134 792149 -60.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS repressor galEp1 792076 792090 -2.0 gttatgctatGGTTATTTCATACCAtaagcctaat nd [BPP] [20]
proximal H-NS repressor galEp1 792092 792106 -18.0 cacttttcgcATCTTTGTTATGCTAtggttatttc nd [BPP] [20]
proximal H-NS repressor galEp1 792110 792124 -36.0 ctaatttattCCATGTCACACTTTTcgcatctttg nd [BPP] [20]
proximal H-NS repressor galEp1 792121 792135 -47.0 aaacgattccACTAATTTATTCCATgtcacacttt nd [BPP] [20]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp1 792059 792092 6.5 ttgttatgctATGGTTATTTCATACCATAAGCCTAATGGAGCGAattatgagag nd [BPP], [GEA] [14], [15], [17], [18], [24], [25], [26]
Note(s): 1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.1GalR is required to bind HU.2HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
8GalR is required to bind HU.
9HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galETK
Gene(s): galK, galT, galE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Lee HJ., et al., 2008
[2] Wang X., et al., 2014
Promoter
Name: galEp2
+1: 792086
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 31
Sequence: taaacgattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttAtttcataccataagcctaat
                         -35                     -10        +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
Repression of galEp2 requires tetramerization of GalR, which is mediated by HU forming a complex called a repressome El Qaidi S,2009and references therein|.
galEp2 is the main promoter during stationary phase, since it produces 70% of the total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [30] Aiba H., et al., 1981
[31] Bown JA., et al., 2000
[32] Busby S., et al., 1983
[23] Rostoks N., et al., 2000
[5] Sur R., et al., 2001
TF binding sites (TFBSs)
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP repressor galEp2 792112 792133 -36.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalR-β-D-galactose1 activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp2 792028 792043 51.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalS-β-D-galactose activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp2 792022 792037 57.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp2 792064 792097 6.5 catctttgttATGCTATGGTTATTTCATACCATAAGCCTAATGGagcgaattat nd [BPP], [GEA] [14], [15], [17], [18], [24], [25]
Note(s): 1In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1GalR is required to facilitate HU binding.2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
4In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
6GalR is required to facilitate HU binding.
7HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galE
Gene(s): galE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Lee HJ., et al., 2008
[2] Wang X., et al., 2014
Promoter
Name: galEp2
+1: 792086
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 31
Sequence: taaacgattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttAtttcataccataagcctaat
                         -35                     -10        +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
Repression of galEp2 requires tetramerization of GalR, which is mediated by HU forming a complex called a repressome El Qaidi S,2009and references therein|.
galEp2 is the main promoter during stationary phase, since it produces 70% of the total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [30] Aiba H., et al., 1981
[31] Bown JA., et al., 2000
[32] Busby S., et al., 1983
[23] Rostoks N., et al., 2000
[5] Sur R., et al., 2001
TF binding sites (TFBSs)
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP repressor galEp2 792112 792133 -36.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalR-β-D-galactose1 activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp2 792028 792043 51.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalS-β-D-galactose activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp2 792022 792037 57.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp2 792064 792097 6.5 catctttgttATGCTATGGTTATTTCATACCATAAGCCTAATGGagcgaattat nd [BPP], [GEA] [14], [15], [17], [18], [24], [25]
Note(s): 1In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1GalR is required to facilitate HU binding.2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
4In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
6GalR is required to facilitate HU binding.
7HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galET
Gene(s): galT, galE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [29] Becker NA., et al., 2014
[1] Lee HJ., et al., 2008
Promoter
Name: galEp2
+1: 792086
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 31
Sequence: taaacgattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttAtttcataccataagcctaat
                         -35                     -10        +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
Repression of galEp2 requires tetramerization of GalR, which is mediated by HU forming a complex called a repressome El Qaidi S,2009and references therein|.
galEp2 is the main promoter during stationary phase, since it produces 70% of the total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [30] Aiba H., et al., 1981
[31] Bown JA., et al., 2000
[32] Busby S., et al., 1983
[23] Rostoks N., et al., 2000
[5] Sur R., et al., 2001
TF binding sites (TFBSs)
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP repressor galEp2 792112 792133 -36.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalR-β-D-galactose1 activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp2 792028 792043 51.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalS-β-D-galactose activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp2 792022 792037 57.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp2 792064 792097 6.5 catctttgttATGCTATGGTTATTTCATACCATAAGCCTAATGGagcgaattat nd [BPP], [GEA] [14], [15], [17], [18], [24], [25]
Note(s): 1In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1GalR is required to facilitate HU binding.2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
4In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
6GalR is required to facilitate HU binding.
7HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit          
Name: galETKM
Synonym(s): OP00032, galETK
Gene(s): galM, galK, galT, galE   Genome Browser M3D Gene expression COLOMBOS
Note(s): The famine-feast cycle of bacterial growth was simulated by Horvath et al. (2010) by diluting stationary-phase cells in fresh medium containing galactose as the sole carbon source. The results showed, via measurements of the proper timing of gene expression in the galactose system, that the system has evolved to respond to environments where galactose levels are unpredictable and do not follow regular feast-famine cycles 20923764
Based on these results, a mathematical model was built where the intracellular D-galactose and cAMP-CRP levels were calculated 20923764
Rob is a transcriptional regulator related to the increase in resistance to antibiotics and is expressed constitutively. Bennik et al. have shown that this regulator represses the transcription of the galT gene and that it forms multiple complexes in the promoter region, suggesting the existence of multiple Rob-binding sites Bennik MH,2000.
Based on the combination of the transcriptional network of the galactose regulon obtained from their experiments and data in the published literature, Semsey S,2007constructed an integrated map of the galactose network.
galETKM, among other genes involved in carbon source transport and metabolism, were downregulated in two MG1655 lysogens carrying closely related Stx2a phages O104 and PA8 1208335|.
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [33] Bouffard GG., et al., 1994
[28] Queen C., et al., 1981
Promoter
Name: galEp2
+1: 792086
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 31
Sequence: taaacgattccactaatttattccatgtcacacttttcgcatctttgttatgctatggttAtttcataccataagcctaat
                         -35                     -10        +1                   
Note(s): The galETKM operon is transcribed from three promoters, galEp1, galEp2, and galEp3.
galEp2 is predominantly expressed when cAMP-CRP is absent, leading to expression of the galE gene and very little galK (natural polarity) 20923764 On the other hand, in the presence of cAMP-CRP, the galEp1 promoter leads to equimolar expression of all the structural genes, while galEp2 transcription is inhibited 6092868. 226959. 20923764
It appears that the galEp2 transcript may serve anabolic requirements, while galEp1 may provide for catabolism of D-galactose as a carbon source 20923764
Repression of galEp2 requires tetramerization of GalR, which is mediated by HU forming a complex called a repressome El Qaidi S,2009and references therein|.
galEp2 is the main promoter during stationary phase, since it produces 70% of the total galE transcripts Ji SC,2011
galEp1 transcription is downregulated earlier than galEp2 transcription at the end of the exponential growth phase Ji SC,2011
Evidence: [CV(RPF)]
[CV(RPF/TIM)]
[CV(TIM)]
[RPF]
[TIM]
Reference(s): [30] Aiba H., et al., 1981
[31] Bown JA., et al., 2000
[32] Busby S., et al., 1983
[23] Rostoks N., et al., 2000
[5] Sur R., et al., 2001
TF binding sites (TFBSs)
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP repressor galEp2 792112 792133 -36.5 acgattccacTAATTTATTCCATGTCACACTTttcgcatctt nd [APIORCISFBSCS], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [8], [16], [21], [22], [23]
[GalR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalR-β-D-galactose1 activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalR1 repressor galEp2 792028 792043 51.5 gagagttctgGTTACCGGTGGTAGCGgttacattgg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [13], [14], [15], [16], [17], [18], [19], [26], [27]
proximal GalR2 repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [7], [8], [9], [10], [11], [12], [13], [14], [15], [16], [17], [18], [19]
[GalS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GalS-β-D-galactose activator galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[GalS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote GalS repressor galEp2 792022 792037 57.5 tctggttaccGGTGGTAGCGGTTACAttggaagtca nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
proximal GalS repressor galEp2 792134 792149 -55.5 ctaaattcttGTGTAAACGATTCCACtaatttattc nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7], [8], [9], [10], [11]
[HU,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal HU1 repressor galEp2 792064 792097 6.5 catctttgttATGCTATGGTTATTTCATACCATAAGCCTAATGGagcgaattat nd [BPP], [GEA] [14], [15], [17], [18], [24], [25]
Note(s): 1In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.
2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.1GalR is required to facilitate HU binding.2In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at low concentrations of galactose, GalR, bound to just one site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
4In the total absence of galactose, HU and GalR repress the expression of the gal operon. But at a low concentration of galactose, GalR, bound to just a site at position -55.5, activates the expression of the operon through the galp2 promoter 16524589.
6GalR is required to facilitate HU binding.
7HU and GalR, binding two sites, repress the expression of the gal operon in the total absence of galactose 16524589.


Transcription unit       
Name: galETKM
Gene(s): galM, galK, galT, galE   Genome Browser M3D Gene expression COLOMBOS
Note(s): Rob is a transcriptional regulator related to the increase in resistance to antibiotics and is expressed constitutively. Bennik et al. have shown that this regulator represses the transcription of the galT gene and that it forms multiple complexes in the promoter region, suggesting the existence of multiple Rob-binding sites Bennik MH,2000.
Based on the combination of the transcriptional network of the galactose regulon obtained from their experiments and data in the published literature, Semsey S,2007constructed an integrated map of the galactose network.
galETKM, among other genes involved in carbon source transport and metabolism, were downregulated in two MG1655 lysogens carrying closely related Stx2a phages O104 and PA8 1208335|.
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [28] Queen C., et al., 1981
[5] Sur R., et al., 2001
Promoter
Name: galEp3
+1: 792177
Distance from start of the gene: 122
Sequence: gcgtcttttttcagataaaaagcgcaatcattcataaaccctctgttttataatcacttaAtcgcgcataaaaaacggcta
Evidence: [TIM]
Reference(s): [5] Sur R., et al., 2001


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  spf antisense translational regulation repressor 789924 789998 CGAATCCGGAGTGTAAGAAATGAGTCTGAAAGAAAAAACACAATCTCTGTTTGCCAACGCATTTGGCTACCCTG [GEA]
[IMP]
[IPI]		 [34]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


Evidence    

 [TIM] Transcription initiation mapping

 [CV(RPF)] cross validation(RPF)

 [CV(RPF/TIM)] cross validation(RPF/TIM)

 [CV(TIM)] cross validation(TIM)

 [RPF] RNA polymerase footprinting

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [CV(GEA)] cross validation(GEA)

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [GEA] Gene expression analysis

 [SM] Site mutation

 [BPP] Binding of purified proteins


Reference(s)    

 [1] Lee HJ., Jeon HJ., Ji SC., Yun SH., Lim HM., 2008, Establishment of an mRNA gradient depends on the promoter: an investigation of polarity in gene expression., J Mol Biol 378(2):318-27

 [2] Wang X., Ji SC., Yun SH., Jeon HJ., Kim SW., Lim HM., 2014, Expression of each cistron in the gal operon can be regulated by transcription termination and generation of a galk-specific mRNA, mK2., J Bacteriol 196(14):2598-606

 [3] Colland F., Fujita N., Kotlarz D., Bown JA., Meares CF., Ishihama A., Kolb A., 1999, Positioning of sigma(S), the stationary phase sigma factor, in Escherichia coli RNA polymerase-promoter open complexes., EMBO J 18(14):4049-59

 [4] Musso RE., de Crombrugghe B., Pastan I., Sklar J., Yot P., Weissman S., 1974, The 5'-terminal nucleotide sequence of galactose messenger ribonucleic acid of Escherichia coli., Proc Natl Acad Sci U S A 71(12):4940-4

 [5] Sur R., Debnath D., Mukhopadhyay J., Parrack P., 2001, A novel RNA polymerase binding site upstream of the galactose promoter in Escherichia coli exhibits promoter-like activity., Eur J Biochem 268(8):2344-50

 [6] Tanaka K., Kusano S., Fujita N., Ishihama A., Takahashi H., 1995, Promoter determinants for Escherichia coli RNA polymerase holoenzyme containing sigma 38 (the rpoS gene product)., Nucleic Acids Res 23(5):827-34

 [7] Geanacopoulos M., Adhya S., 1997, Functional characterization of roles of GalR and GalS as regulators of the gal regulon., J Bacteriol 179(1):228-34

 [8] Semsey S., Krishna S., Sneppen K., Adhya S., 2007, Signal integration in the galactose network of Escherichia coli., Mol Microbiol 65(2):465-76

 [9] Weickert MJ., Adhya S., 1992, Isorepressor of the gal regulon in Escherichia coli., J Mol Biol 226(1):69-83

 [10] Weickert MJ., Adhya S., 1993, The galactose regulon of Escherichia coli., Mol Microbiol 10(2):245-51

 [11] Weickert MJ., Adhya S., 1993, Control of transcription of gal repressor and isorepressor genes in Escherichia coli., J Bacteriol 175(1):251-8

 [12] Choy HE., Hanger RR., Aki T., Mahoney M., Murakami K., Ishihama A., Adhya S., 1997, Repression and activation of promoter-bound RNA polymerase activity by Gal repressor., J Mol Biol 272(3):293-300

 [13] Kar S., Adhya S., 2001, Recruitment of HU by piggyback: a special role of GalR in repressosome assembly., Genes Dev 15(17):2273-81

 [14] Lia G., Bensimon D., Croquette V., Allemand JF., Dunlap D., Lewis DE., Adhya S., Finzi L., 2003, Supercoiling and denaturation in Gal repressor/heat unstable nucleoid protein (HU)-mediated DNA looping., Proc Natl Acad Sci U S A 100(20):11373-7

 [15] Lyubchenko YL., Shlyakhtenko LS., Aki T., Adhya S., 1997, Atomic force microscopic demonstration of DNA looping by GalR and HU., Nucleic Acids Res 25(4):873-6

 [16] Mandal N., Su W., Haber R., Adhya S., Echols H., 1990, DNA looping in cellular repression of transcription of the galactose operon., Genes Dev 4(3):410-8

 [17] Perez N., Rehault M., Amouyal M., 2000, A functional assay in Escherichia coli to detect non-assisted interaction between galactose repressor dimers., Nucleic Acids Res 28(18):3600-4

 [18] Semsey S., Tolstorukov MY., Virnik K., Zhurkin VB., Adhya S., 2004, DNA trajectory in the Gal repressosome., Genes Dev 18(15):1898-907

 [19] Virnik K., Lyubchenko YL., Karymov MA., Dahlgren P., Tolstorukov MY., Semsey S., Zhurkin VB., Adhya S., 2003, "Antiparallel" DNA loop in gal repressosome visualized by atomic force microscopy., J Mol Biol 334(1):53-63

 [20] Rimsky S., Spassky A., 1990, Sequence determinants for H1 binding on Escherichia coli lac and gal promoters., Biochemistry 29(15):3765-71

 [21] Irani M., Musso R., Adhya S., 1989, Cyclic-AMP-dependent switch in initiation of transcription from the two promoters of the Escherichia coli gal operon: identification and assay of 5'-triphosphate ends of mRNA by GTP:RNA guanyltransferase., J Bacteriol 171(3):1623-30

 [22] Merkel TJ., Nelson DM., Brauer CL., Kadner RJ., 1992, Promoter elements required for positive control of transcription of the Escherichia coli uhpT gene., J Bacteriol 174(9):2763-70

 [23] Rostoks N., Park S., Choy HE., 2000, Reiterative transcription initiation from galP2 promoter of Escherichia coli., Biochim Biophys Acta 1491(1-3):185-95

 [24] Aki T., Adhya S., 1997, Repressor induced site-specific binding of HU for transcriptional regulation., EMBO J 16(12):3666-74

 [25] Geanacopoulos M., Vasmatzis G., Zhurkin VB., Adhya S., 2001, Gal repressosome contains an antiparallel DNA loop., Nat Struct Biol 8(5):432-6

 [26] Lewis DE., Geanacopoulos M., Adhya S., 1999, Role of HU and DNA supercoiling in transcription repression: specialized nucleoprotein repression complex at gal promoters in Escherichia coli., Mol Microbiol 31(2):451-61

 [27] Semsey S., Geanacopoulos M., Lewis DE., Adhya S., 2002, Operator-bound GalR dimers close DNA loops by direct interaction: tetramerization and inducer binding., EMBO J 21(16):4349-56

 [28] Queen C., Rosenberg M., 1981, Differential translation efficiency explains discoordinate expression of the galactose operon., Cell 25(1):241-9

 [29] Becker NA., Greiner AM., Peters JP., Maher LJ., 2014, Bacterial promoter repression by DNA looping without protein-protein binding competition., Nucleic Acids Res 42(9):5495-504

 [30] Aiba H., Adhya S., de Crombrugghe B., 1981, Evidence for two functional gal promoters in intact Escherichia coli cells., J Biol Chem 256(22):11905-10

 [31] Bown JA., Kolb A., Meares CF., Ishihama A., Minchin SD., Busby SJ., 2000, Positioning of region 4 of the Escherichia coli RNA polymerase sigma(70) subunit by a transcription activator., J Bacteriol 182(10):2982-4

 [32] Busby S., Kotlarz D., Buc H., 1983, Deletion mutagenesis of the Escherichia coli galactose operon promoter region., J Mol Biol 167(2):259-74

 [33] Bouffard GG., Rudd KE., Adhya SL., 1994, Dependence of lactose metabolism upon mutarotase encoded in the gal operon in Escherichia coli., J Mol Biol 244(3):269-78

 [34] Moller T., Franch T., Udesen C., Gerdes K., Valentin-Hansen P., 2002, Spot 42 RNA mediates discoordinate expression of the E. coli galactose operon., Genes Dev 16(13):1696-706

RegulonDB