RegulonDB RegulonDB 10.6.3: Operon Form
   

hns operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: hns
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: hns
Synonym(s): OP00190
Gene(s): hns   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, ATTTATTGGCGGCACAAAATAAA, in the intergenic region of the divergent genes tdk and hns. This demonstration was based on different statistical methods |CITS:[21070640]|, but it is not known if NagC regulates transcription in both directions.
The expression of the gene hns is increased under acidic growth conditions in microaerobiosis |CITS:[23274360]|.
H-NS, through its genome position, affects its own transcription activity, which is dependent on the growth phase and the growth rate of the cells |CITS:[25701587]|. This is the first evidence for modulation of gene expression dependent on the chromosomal position of a global regulator. Genomic position plays a significant role in the adaptation of cells to environmental changes |CITS:[25701587]|.
Reference(s): [1] Ueguchi C., et al., 1993
Promoter
Name: hnsp
+1: 1292958
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 36
Sequence: tttgaattccttacattcctggctattgcacaactgaatttaaggctctattattacctcAacaaaccaccccaatataag
                          -10                    -35        +1                   
Evidence: [HTTIM]    
[RS-EPT-CBR]
[TIM] ; Method: Primer Extension
[TIM]
Reference(s): [2] Dersch P., et al., 1993
[3] La Teana A., et al., 1989
[4] Mendoza-Vargas A., et al., 2009
[5] Salgado H, et al., 2012
Terminator(s)
Type: rho-independent
Sequence: cggacaataaAAAATCCCGCCGCTGGCGGGATTTTaagcaagtgc
Reference(s): [6] Chib S., et al., 2012
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd CspA activator hnsp nd nd nd nd nd [BPP] [8], [11], [12]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis activator hnsp 1292927 1292941 25.0 caccccaataTAAGTTTGAGATTACtacaatgagc nd [BPP] [7], [8]
proximal Fis activator hnsp 1292961 1292975 -10.0 ctgaatttaaGGCTCTATTATTACCtcaacaaacc nd [BPP] [7], [8]
proximal Fis activator hnsp 1293022 1293036 -71.0 ttattggcggCACAAAATAAAGAACaattttgaat nd [BPP] [7], [8]
remote Fis activator hnsp 1293069 1293083 -118.0 tagggctataTGCCGCGTCTTTTCTggctaatttt nd [BPP] [7], [8]
remote Fis activator hnsp 1293125 1293139 -174.0 atgtgacatgAATCAGGAAGTTTTAacctcacgtg nd [BPP] [7], [8]
remote Fis activator hnsp 1293194 1293208 -243.0 ggaattctcgTAAACACAACTAATAcagaagactg nd [BPP] [7], [8]
remote Fis activator hnsp 1293233 1293247 -282.0 ttattgcgacTGTTCTACTTTTCATcattcgctta nd [BPP] [7], [8]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadX activator hnsp nd nd nd nd nd [GEA] [10]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS1 repressor hnsp 1292991 1293005 -40.0 gaattccttaCATTCCTGGCTATTGcacaactgaa nd [BPP], [GEA], [HIBSCS] [1], [2], [7], [8], [9]
remote H-NS repressor hnsp 1293064 1293078 -113.0 ctatatgccgCGTCTTTTCTGGCTAattttatgaa nd [BPP], [GEA] [1], [7], [8], [9]
remote H-NS repressor hnsp 1293133 1293147 -182.0 cccataaaatGTGACATGAATCAGGaagttttaac nd [BPP], [GEA] [1], [7], [8], [9]
Note(s): 1Autoregulation of hns expression is particularly pronounced during log phase.
8Autoregulation of hns expression is particularly pronounced during log phase.
External database links:
UNIPROT:
P15277


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  dsrA antisense translational regulation repressor 1292904 1292916 GAAGCACTTAAA [GEA] [13]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"




Reference(s)    

 [1] Ueguchi C., Kakeda M., Mizuno T., 1993, Autoregulatory expression of the Escherichia coli hns gene encoding a nucleoid protein: H-NS functions as a repressor of its own transcription., Mol Gen Genet 236(2-3):171-8

 [2] Dersch P., Schmidt K., Bremer E., 1993, Synthesis of the Escherichia coli K-12 nucleoid-associated DNA-binding protein H-NS is subjected to growth-phase control and autoregulation., Mol Microbiol 8(5):875-89

 [3] La Teana A., Falconi M., Scarlato V., Lammi M., Pon CL., 1989, Characterization of the structural genes for the DNA-binding protein H-NS in Enterobacteriaceae., FEBS Lett 244(1):34-8

 [4] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [5] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Mu¿¿iz-Rascado L, Garc¿¿a-Sotelo JS, Weiss V, Solano-Lira H, Mart¿¿nez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hern¿¿ndez S, Alquicira-Hern¿¿ndez K, L¿¿pez-Fuentes A, Porr¿¿n-Sotelo L, Huerta AM, Bonavides-Mart¿¿nez C, Balderas-Mart¿¿nez YI, Pannier L, Olvera M, Labastida A, Jim¿¿nez-Jacinto V, Vega-Alvarado L, Del Moral-Ch¿¿vez V, Hern¿¿ndez-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [6] Chib S., Mahadevan S., 2012, Involvement of the Global Regulator H-NS in the Survival of Escherichia coli in Stationary Phase., J Bacteriol 194(19):5285-93

 [7] Falconi M., Brandi A., La Teana A., Gualerzi CO., Pon CL., 1996, Antagonistic involvement of FIS and H-NS proteins in the transcriptional control of hns expression., Mol Microbiol 19(5):965-75

 [8] Giangrossi M., Gualerzi CO., Pon CL., 2001, Mutagenesis of the downstream region of the Escherichia coli hns promoter., Biochimie 83(2):251-9

 [9] Falconi M., Higgins NP., Spurio R., Pon CL., Gualerzi CO., 1993, Expression of the gene encoding the major bacterial nucleotide protein H-NS is subject to transcriptional auto-repression., Mol Microbiol 10(2):273-82

 [10] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [11] Brandi A., Pon CL., Gualerzi CO., 1994, Interaction of the main cold shock protein CS7.4 (CspA) of Escherichia coli with the promoter region of hns., Biochimie 76(10-11):1090-8

 [12] La Teana A., Brandi A., Falconi M., Spurio R., Pon CL., Gualerzi CO., 1991, Identification of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein H-NS., Proc Natl Acad Sci U S A 88(23):10907-11

 [13] Lease RA., Cusick ME., Belfort M., 1998, Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci., Proc Natl Acad Sci U S A 95(21):12456-61


RegulonDB