RegulonDB RegulonDB 10.8: Operon Form
   

hns operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: hns
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: hns
Synonym(s): OP00190
Gene(s): hns   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, ATTTATTGGCGGCACAAAATAAA, in the intergenic region of the divergent genes tdk and hns. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
The expression of the gene hns is increased under acidic growth conditions in microaerobiosis Marzan LW,2013
H-NS, through its genome position, affects its own transcription activity, which is dependent on the growth phase and the growth rate of the cells 25701587 This is the first evidence for modulation of gene expression dependent on the chromosomal position of a global regulator. Genomic position plays a significant role in the adaptation of cells to environmental changes 25701587
Reference(s): [1] Ueguchi C., et al., 1993
Promoter
Name: hnsp
+1: 1292958
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 36
Sequence: tttgaattccttacattcctggctattgcacaactgaatttaaggctctattattacctcAacaaaccaccccaatataag
                          -35                    -10        +1                   
Evidence: [CV(RS-EPT-CBR)]
[CV(TIM)]
[HTIM]
[RS-EPT-CBR]
[TIM]
Reference(s): [2] Dersch P., et al., 1993
[3] La Teana A., et al., 1989
[4] Mendoza-Vargas A., et al., 2009
[5] Salgado H, et al., 2012
Terminator(s)
Type: rho-independent
Sequence: cggacaataaAAAATCCCGCCGCTGGCGGGATTTTaagcaagtgc
Reference(s): [6] Chib S., et al., 2012
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd CspA activator hnsp nd nd nd nd nd [BPP] [8], [11], [12]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis activator hnsp 1292927 1292941 25.0 caccccaataTAAGTTTGAGATTACtacaatgagc nd [BPP] [7], [8]
proximal Fis activator hnsp 1292961 1292975 -10.0 ctgaatttaaGGCTCTATTATTACCtcaacaaacc nd [BPP] [7], [8]
proximal Fis activator hnsp 1293022 1293036 -71.0 ttattggcggCACAAAATAAAGAACaattttgaat nd [BPP] [7], [8]
remote Fis activator hnsp 1293069 1293083 -118.0 tagggctataTGCCGCGTCTTTTCTggctaatttt nd [BPP] [7], [8]
remote Fis activator hnsp 1293125 1293139 -174.0 atgtgacatgAATCAGGAAGTTTTAacctcacgtg nd [BPP] [7], [8]
remote Fis activator hnsp 1293194 1293208 -243.0 ggaattctcgTAAACACAACTAATAcagaagactg nd [BPP] [7], [8]
remote Fis activator hnsp 1293233 1293247 -282.0 ttattgcgacTGTTCTACTTTTCATcattcgctta nd [BPP] [7], [8]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadX activator hnsp nd nd nd nd nd [GEA] [10]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal H-NS1 repressor hnsp 1292991 1293005 -40.0 gaattccttaCATTCCTGGCTATTGcacaactgaa nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1], [2], [7], [8], [9]
remote H-NS repressor hnsp 1293064 1293078 -113.0 ctatatgccgCGTCTTTTCTGGCTAattttatgaa nd [BPP], [GEA] [1], [7], [8], [9]
remote H-NS repressor hnsp 1293133 1293147 -182.0 cccataaaatGTGACATGAATCAGGaagttttaac nd [BPP], [GEA] [1], [7], [8], [9]
Note(s): 1Autoregulation of hns expression is particularly pronounced during log phase.
8Autoregulation of hns expression is particularly pronounced during log phase.


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  dsrA antisense translational regulation repressor 1292904 1292916 GAAGCACTTAAA [GEA] [13]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"




Reference(s)    

 [1] Ueguchi C., Kakeda M., Mizuno T., 1993, Autoregulatory expression of the Escherichia coli hns gene encoding a nucleoid protein: H-NS functions as a repressor of its own transcription., Mol Gen Genet 236(2-3):171-8

 [2] Dersch P., Schmidt K., Bremer E., 1993, Synthesis of the Escherichia coli K-12 nucleoid-associated DNA-binding protein H-NS is subjected to growth-phase control and autoregulation., Mol Microbiol 8(5):875-89

 [3] La Teana A., Falconi M., Scarlato V., Lammi M., Pon CL., 1989, Characterization of the structural genes for the DNA-binding protein H-NS in Enterobacteriaceae., FEBS Lett 244(1):34-8

 [4] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [5] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [6] Chib S., Mahadevan S., 2012, Involvement of the Global Regulator H-NS in the Survival of Escherichia coli in Stationary Phase., J Bacteriol 194(19):5285-93

 [7] Falconi M., Brandi A., La Teana A., Gualerzi CO., Pon CL., 1996, Antagonistic involvement of FIS and H-NS proteins in the transcriptional control of hns expression., Mol Microbiol 19(5):965-75

 [8] Giangrossi M., Gualerzi CO., Pon CL., 2001, Mutagenesis of the downstream region of the Escherichia coli hns promoter., Biochimie 83(2):251-9

 [9] Falconi M., Higgins NP., Spurio R., Pon CL., Gualerzi CO., 1993, Expression of the gene encoding the major bacterial nucleotide protein H-NS is subject to transcriptional auto-repression., Mol Microbiol 10(2):273-82

 [10] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [11] Brandi A., Pon CL., Gualerzi CO., 1994, Interaction of the main cold shock protein CS7.4 (CspA) of Escherichia coli with the promoter region of hns., Biochimie 76(10-11):1090-8

 [12] La Teana A., Brandi A., Falconi M., Spurio R., Pon CL., Gualerzi CO., 1991, Identification of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein H-NS., Proc Natl Acad Sci U S A 88(23):10907-11

 [13] Lease RA., Cusick ME., Belfort M., 1998, Riboregulation in Escherichia coli: DsrA RNA acts by RNA:RNA interactions at multiple loci., Proc Natl Acad Sci U S A 95(21):12456-61


RegulonDB