RegulonDB RegulonDB 10.8: Operon Form
   

argT-hisJQMP operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: argT-hisJQMP
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: hisJQMP
Gene(s): hisP, hisM, hisQ, hisJ   Genome Browser M3D Gene expression COLOMBOS
Note(s): ArgR regulator can control hisJ gene expression through topological changes on the promoter region, inhibiting RNA polymerase binding Caldara M,2007
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Promoter
Name: hisJp
+1: 2426837
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 49
Sequence: atacgtctaacggggcgggatattttgccttgatggtcaattttatggcacgataagtgtAacaaacctgtaaatattccc
                         -35                     -10        +1                   
Evidence: [CV(RS-EPT-CBR)]
[CV(TIM)]
[IEP]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Caldara M., et al., 2007
[2] Salgado H, et al., 2012
[3] Zaslaver A., et al., 2006
TF binding sites (TFBSs)
[ArgR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArgR-L-arginine repressor hisJp 2426891 2426909 -62.5 taagcattttTAATGAAAAATAATACGTCtaacggggcg nd [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [1], [4], [5]
proximal ArgR-L-arginine repressor hisJp 2426912 2426930 -83.5 tggtgcattgAAATGCATACTTAAGCATTtttaatgaaa nd [BPP], [CV(SM)], [GEA], [SM] [1]
[H-NS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS activator hisJp nd nd nd nd nd [GEA] [6]


Transcription unit          
Name: argT-hisJQMP
Gene(s): hisP, hisM, hisQ, hisJ, argT   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [7] Zimmer DP., et al., 2000
Promoter
Name: argTp
+1: 2427849
Sigma Factor: Sigma54 Sigmulon
Distance from start of the gene: 58
Sequence: tatttaacgttgaatgttactgttgtcgtcaagatggcataagacctgcatgaaagagccTgcaaacacacaacacaatac
                                   -24         -12          +1                   
Note(s): We assigned a putative transcription start site to this promoter based on the observation that the majority of the σ54-dependent promoters, whose transcription start sites were determined experimentally, present a distance of 11 nucleotides between the transcription start site and the -12 box Barrios H,1999.
Evidence: [AIPP]
Reference(s): [8] Barrios H., et al., 1999
[9] Reitzer L., et al., 2001
[10] Schmitz G., et al., 1987
TF binding sites (TFBSs)
[NtrC,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NtrC-Pasp activator argTp 2427924 2427940 -83.0 tatcttcaacTTCAGGACAATAATGCAacgtcttatt nd [AIBSCS], [CV(GEA)], [GEA] [7]
remote NtrC-Pasp activator argTp 2428031 2428047 -190.0 actccgctgtTGCCCTGTTTCAGGGCAattttgcaac nd [AIBSCS], [CV(GEA)], [GEA] [7]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp inhibition argTp The argT promoter is negatively affected by ppGpp in vivo Rowley KB,1993and in vitro during the stringent response Toulokhonov II,2001.
Based on results of nuclease protection and primer extension assays, leuV, argT, metT, and leuX were determined to be involved in the stringent response induced by serine hydroxamate Rowley KB,1993. 		[GEA]
[IEP] 		[11]
[12]
Evidence: [GEA] Gene expression analysis
[IEP] Inferred from expression pattern
Reference(s): [11] Rowley KB., et al., 1993
[12] Toulokhonov II., et al., 2001


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  gcvB antisense translational regulation repressor 2427824 2427849 TGCAAACACACAACACAATACACAA
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


Evidence    

 [CV(RS-EPT-CBR)] cross validation(RS-EPT-CBR)

 [CV(TIM)] cross validation(TIM)

 [IEP] Inferred from expression pattern

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [TIM] Transcription initiation mapping

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [BPP] Binding of purified proteins

 [CV(GEA)] cross validation(GEA)

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [GEA] Gene expression analysis

 [SM] Site mutation

 [AIPP] Automated inference of promoter position


Reference(s)    

 [1] Caldara M., Minh PN., Bostoen S., Massant J., Charlier D., 2007, ArgR-dependent repression of arginine and histidine transport genes in Escherichia coli K-12., J Mol Biol 373(2):251-67

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Zaslaver A., Bren A., Ronen M., Itzkovitz S., Kikoin I., Shavit S., Liebermeister W., Surette MG., Alon U., 2006, A comprehensive library of fluorescent transcriptional reporters for Escherichia coli., Nat Methods 3(8):623-8

 [4] Caldara M., Charlier D., Cunin R., 2006, The arginine regulon of Escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation., Microbiology 152(Pt 11):3343-54

 [5] Makarova KS., Mironov AA., Gelfand MS., 2001, Conservation of the binding site for the arginine repressor in all bacterial lineages., Genome Biol 2(4):RESEARCH0013

 [6] White-Ziegler CA., Malhowski AJ., Young S., 2007, Human body temperature (37degrees C) increases the expression of iron, carbohydrate, and amino acid utilization genes in Escherichia coli K-12., J Bacteriol 189(15):5429-40

 [7] Zimmer DP., Soupene E., Lee HL., Wendisch VF., Khodursky AB., Peter BJ., Bender RA., Kustu S., 2000, Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogen limitation., Proc Natl Acad Sci U S A 97(26):14674-9

 [8] Barrios H., Valderrama B., Morett E., 1999, Compilation and analysis of sigma(54)-dependent promoter sequences., Nucleic Acids Res 27(22):4305-13

 [9] Reitzer L., Schneider BL., 2001, Metabolic context and possible physiological themes of sigma(54)-dependent genes in Escherichia coli., Microbiol Mol Biol Rev 65(3):422-44, table of contents

 [10] Schmitz G., Durre P., Mullenbach G., Ames GF., 1987, Nitrogen regulation of transport operons: analysis of promoters argTr and dhuA., Mol Gen Genet 209(2):403-7

 [11] Rowley KB., Elford RM., Roberts I., Holmes WM., 1993, In vivo regulatory responses of four Escherichia coli operons which encode leucyl-tRNAs., J Bacteriol 175(5):1309-15

 [12] Toulokhonov II., Shulgina I., Hernandez VJ., 2001, Binding of the transcription effector ppGpp to Escherichia coli RNA polymerase is allosteric, modular, and occurs near the N terminus of the beta'-subunit., J Biol Chem 276(2):1220-5

RegulonDB