RegulonDB RegulonDB 10.6.3: Operon Form
   

argT-hisJQMP operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: argT-hisJQMP
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: hisJQMP
Gene(s): hisP, hisM, hisQ, hisJ   Genome Browser M3D Gene expression COLOMBOS
Note(s): ArgR regulator can control hisJ gene expression through topological changes on the promoter region, inhibiting RNA polymerase binding |CITS:[17850814]|.
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Promoter
Name: hisJp
+1: 2426837
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 49
Sequence: atacgtctaacggggcgggatattttgccttgatggtcaattttatggcacgataagtgtAacaaacctgtaaatattccc
                         -10                     -35        +1                   
Evidence: [IEP]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Caldara M., et al., 2007
[2] Salgado H, et al., 2012
[3] Zaslaver A., et al., 2006
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArgR-L-arginine repressor hisJp 2426891 2426909 -62.5 taagcattttTAATGAAAAATAATACGTCtaacggggcg nd [AIBSCS], [BPP], [GEA], [SM] [1], [4], [5]
proximal ArgR-L-arginine repressor hisJp 2426912 2426930 -83.5 tggtgcattgAAATGCATACTTAAGCATTtttaatgaaa nd [BPP], [GEA], [SM] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS activator hisJp nd nd nd nd nd [GEA] [6]


Transcription unit          
Name: argT-hisJQMP
Gene(s): hisP, hisM, hisQ, hisJ, argT   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [7] Zimmer DP., et al., 2000
Promoter
Name: argTp
+1: 2427849
Sigma Factor: Sigma54 Sigmulon
Distance from start of the gene: 58
Sequence: tatttaacgttgaatgttactgttgtcgtcaagatggcataagacctgcatgaaagagccTgcaaacacacaacacaatac
                                   -12         -24          +1                   
Note(s): We assigned a putative transcription start site to this promoter based on the observation that the majority of the σ54-dependent promoters, whose transcription start sites were determined experimentally, present a distance of 11 nucleotides between the transcription start site and the -12 box Barrios H,1999.
Evidence: [AIPP]
Reference(s): [8] Barrios H., et al., 1999
[9] Reitzer L., et al., 2001
[10] Schmitz G., et al., 1987
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NtrC-Pasp activator argTp 2427924 2427940 -83.0 tatcttcaacTTCAGGACAATAATGCAacgtcttatt nd [AIBSCS], [GEA] [7]
remote NtrC-Pasp activator argTp 2428031 2428047 -190.0 actccgctgtTGCCCTGTTTCAGGGCAattttgcaac nd [AIBSCS], [GEA] [7]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp inhibition argTp The argT promoter is negatively affected by ppGpp in vivo |CITS:[7680341]| and in vitro during the stringent response |CITS: [11035017]|.
Based on results of nuclease protection and primer extension assays, leuV, argT, metT, and leuX were determined to be involved in the stringent response induced by serine hydroxamate |CITS: [7680341]|.
[GEA]
[IEP]
[11]
[12]
Evidence: [GEA] Gene expression analysis
[IEP] Inferred from expression pattern
Reference(s): [11] Rowley KB., et al., 1993
[12] Toulokhonov II., et al., 2001


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  gcvB antisense translational regulation repressor 2427824 2427849 TGCAAACACACAACACAATACACAA
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"




Reference(s)    

 [1] Caldara M., Minh PN., Bostoen S., Massant J., Charlier D., 2007, ArgR-dependent Repression of Arginine and Histidine Transport Genes in Escherichia coli K-12., J Mol Biol 373(2):251-67

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Mu¿¿iz-Rascado L, Garc¿¿a-Sotelo JS, Weiss V, Solano-Lira H, Mart¿¿nez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hern¿¿ndez S, Alquicira-Hern¿¿ndez K, L¿¿pez-Fuentes A, Porr¿¿n-Sotelo L, Huerta AM, Bonavides-Mart¿¿nez C, Balderas-Mart¿¿nez YI, Pannier L, Olvera M, Labastida A, Jim¿¿nez-Jacinto V, Vega-Alvarado L, Del Moral-Ch¿¿vez V, Hern¿¿ndez-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Zaslaver A., Bren A., Ronen M., Itzkovitz S., Kikoin I., Shavit S., Liebermeister W., Surette MG., Alon U., 2006, A comprehensive library of fluorescent transcriptional reporters for Escherichia coli., Nat Methods 3(8):623-8

 [4] Caldara M., Charlier D., Cunin R., 2006, The arginine regulon of Escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation., Microbiology 152(Pt 11):3343-54

 [5] Makarova KS., Mironov AA., Gelfand MS., 2001, Conservation of the binding site for the arginine repressor in all bacterial lineages., Genome Biol 2(4):RESEARCH0013

 [6] White-Ziegler CA., Malhowski AJ., Young S., 2007, Human body temperature (37degrees C) increases the expression of iron, carbohydrate, and amino acid utilization genes in Escherichia coli K-12., J Bacteriol 189(15):5429-40

 [7] Zimmer DP., Soupene E., Lee HL., Wendisch VF., Khodursky AB., Peter BJ., Bender RA., Kustu S., 2000, Nitrogen regulatory protein C-controlled genes of Escherichia coli: scavenging as a defense against nitrogen limitation., Proc Natl Acad Sci U S A 97(26):14674-9

 [8] Barrios H., Valderrama B., Morett E., 1999, Compilation and analysis of sigma(54)-dependent promoter sequences., Nucleic Acids Res 27(22):4305-13

 [9] Reitzer L., Schneider BL., 2001, Metabolic context and possible physiological themes of sigma(54)-dependent genes in Escherichia coli., Microbiol Mol Biol Rev 65(3):422-44, table of contents

 [10] Schmitz G., Durre P., Mullenbach G., Ames GF., 1987, Nitrogen regulation of transport operons: analysis of promoters argTr and dhuA., Mol Gen Genet 209(2):403-7

 [11] Rowley KB., Elford RM., Roberts I., Holmes WM., 1993, In vivo regulatory responses of four Escherichia coli operons which encode leucyl-tRNAs., J Bacteriol 175(5):1309-15

 [12] Toulokhonov II., Shulgina I., Hernandez VJ., 2001, Binding of the transcription effector ppGpp to Escherichia coli RNA polymerase is allosteric, modular, and occurs near the N terminus of the beta'-subunit., J Biol Chem 276(2):1220-5


RegulonDB