RegulonDB RegulonDB 10.10: Operon Form
   

flhDC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: flhDC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: flhDC
Synonym(s): OP00183
Gene(s): flhC, flhD   Genome Browser M3D Gene expression COLOMBOS
Note(s): The transcription of the flhDC operon is repressed in acidic phospholipid-deficient cells, but the gadW, metE, and yeaB genes in multicopy suppress this repression through the reduction of overexpression of RpoS caused by the same mutation in the gene producing acidic phospholipid Uchiyama J, Nobue Y, Zhao H, Matsuzaki H, Nagahama H, Matsuoka S, Matsumoto K, Hara H,2010 The mechanism for this is not known.
Under motility-inducing environmental growth conditions, a motile element (IS5) is inserted into the upstream region of the flhDC operon. This event appears to enhance the expression of the operon, because motility and biofilm formation are increased Wang X, Wood TK,2011CITS: [28100305]|. IS5 insertion disrupts the H-NS binding site, thus preventing transcriptional repression of the operon Wang X, Wood TK,2011 Three novel cis-acting IS elements upstream of flhDC (IS5, located at -166 and -315, IS1, inserted at -303, and a trans-acting missense mutation in lrhA) were found that enhanced motility by relieving transcriptional repression of flhDC Lee C, Park C,2013 Both effects act in parallel, suggesting their apparently independent regulation of flagellar expression Lee C, Park C,2013 Several insertion sequence (IS) elements upstream of the promoter for flhDC stimulate motility independently of orientation and have a long-range effect Fahrner KA, Berg HC,2015
fllhDC expression is enhanced by AtoSC in the presence of acetoacetate Theodorou MC, Theodorou EC, Kyriakidis DA,2012.
Under NlpE outer membrane lipoprotein overexpression, the transcription of the flhC gene is decreased Raivio TL,2013
In a study where it was shown that the L-tryptophan eradicated persister cells, it was observed that the exogenous amino acid downregulated the expression of flhDC as well as other flagellar genes Li Y, Liu B, Guo J, Cong H, He S, Zhou H, Zhu F, Wang Q, Zhang L,2019.
Based on mutations analysis, it was shown that OmpR and RcsB abolish temporal and spatial changes in expression of flhDC Samanta P, Clark ER, Knutson K, Horne SM, Prüß BM,2013
Single nucleotide changes in the -10 element and the spacer of the flhDC promoter, and also in the cAMP-CRP-binding region, increase motility Fahrner KA, Berg HC,2015
Several mutations in the flhDC promoter allow motility in H-NS mutant strains Fahrner KA, Berg HC,2015
YjjQ represses transcription of the flhDC operon independently from the previously characterized RcsA-RcsB repressor, even though the two DNA-binding motifs contain overlapping sequences Wiebe H,2015 flhDC requires a specific transcription rate to maintain optimal flagellum numbers Albanna A, Sim M, Hoskisson PA, Gillespie C, Rao CV, Aldridge PD,2018
The impact of a two-component signal transduction system (2CSTS) was reviewed with regard to EnvZ/OmpT, RscCDB, CheAYB, and QueCB. Studies of the effects of changes in signaling on the expression of motility and biofilm genes revealed the involvement of the flhDC operon in the induction of changes in motility in the early phases of biofilm development and the swim-or-stick switch that allows bacteria to transit from reversible to irreversible attachment Prüß BM,2017.
Orthologous flhDC from E. coli can functionally complement flhDC in S. Enterica, and flhCEC is not functionally identical to flhCST Albanna A, Sim M, Hoskisson PA, Gillespie C, Rao CV, Aldridge PD,2018 The phenotypic differences between species arise from adaptations during evolution to expand or modify cellular function with respect to movement within specific environmental niches Albanna A, Sim M, Hoskisson PA, Gillespie C, Rao CV, Aldridge PD,2018
The mRNA that contains the flhD gene has been observed mainly in the poles of the cell Kannaiah S, Livny J, Amster-Choder O,2019.
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Bertin P., et al., 1994
[2] Lehti TA., et al., 2012
[3] Shin S., et al., 1995
Promoter
Name: flhDp
+1: 1978395
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 198
Sequence: tattgaaaatcgcagcccccctccgttgtatgtgcgtgtagtgacgagtacagttgcgtcGatttaggaaaaatcttagat
                          -35                    -10        +1                   
Evidence: [ICWHO]
[TIM]
Reference(s): [4] Barker CS., et al., 2004
[5] Huerta AM., et al., 2003
[3] Shin S., et al., 1995
[6] Soutourina O., et al., 1999
[7] Wei BL., et al., 2001
Terminator(s)
Type: rho-independent
Sequence: ttaacgcgcgATTGGGGCAAAAAAAAGCAGCGGTACGTCGTTACCGCTGCTGGAATGTTGCGCCTcaccgtatca
Reference(s): [11] Feng CQ., et al., 2019
[12] Lesnik EA., et al., 2001
TF binding sites (TFBSs)
[AcrR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal AcrR repressor flhDp 1978422 1978432 -31.5 agcccccctcCGTTGTATGTGcgtgtagtga nd [GEA], [APIORCISFBSCS] [16]
[CRP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP activator flhDp 1978456 1978477 -71.5 attgagtgttTTGTGTGATCTGCATCACGCATtattgaaaat nd [GEA], [APIORCISFBSCS], [BPP] [6], [14], [15]
[FliZ,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FliZ repressor flhDp 1978370 1978399 12.0 agtacagttgCGTCGATTTAGGAAAAATCTTAGATAAGTGtaaagaccca nd [GEA], [BPP] [20]
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fur-Fe2+ repressor flhDp 1978272 1978290 115.0 caactattctAATGCTAATTATTTTTTACcggggcttcc nd [AIBSCS] [21]
[H-NS,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS activator flhDp nd nd nd nd nd [GEA], [BPP] [6]
[HdfR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd HdfR repressor flhDp nd nd nd nd nd [GEA], [BPP] [23]
[IHF,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal IHF repressor flhDp 1978481 1978493 -92.0 ccatttatgtTAAGTAATTGAGTgttttgtgtg nd [APIORCISFBSCS] [3]
[LrhA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote LrhA repressor flhDp 1978500 1978514 -112.0 tcaataagttGGAGTCATTACCCATttatgttaag nd [GEA], [BPP] [13]
[MatA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd MatA repressor flhDp nd nd nd nd nd [GEA], [BPP] [2]
[OmpR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated repressor flhDp 1978368 1978387 18.5 tcgatttaggAAAAATCTTAGATAAGTGTAaagacccatt nd [APIORCISFBSCS] nd
remote OmpR-phosphorylated repressor flhDp 1978531 1978550 -145.5 caaagtcatcGGGCATTATCTGAACATAAAacactatcaa nd [APIORCISFBSCS] nd
[QseB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd QseB-Phosphorylated activator flhDp nd nd nd nd nd [GEA], [BPP] [22]
[RcsAB,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RcsAB repressor flhDp 1978378 1978392 11.0 ttgcgtcgatTTAGGAAAAATCTTAgataagtgta nd [GEA], [AIBSCS], [SM] [18], [19]
[YjjQ,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal YjjQ repressor flhDp 1978378 1978392 11.0 ttgcgtcgatTTAGGAAAAATCTTAgataagtgta nd [GEA], [AIBSCS], [SM] [17]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA OmrB flhDC repressor 1978206 1978251 CCCAGAAUAACCAACUUUAUUUUUAUGCGGUUUCACCGCACCCCGU nd [IMP], [SM] [8]
small regulatory RNA McaS flhDC activator 1978274 1978283 AAAAAAUAAU TRANSLATION-BLOCKING [IEP], [IMP] [9]
small regulatory RNA ArcZ flhDC repressor 1978244 1978261 CACCCCGUGAUGUCGCCG nd [IMP], [SM] [8]
small regulatory RNA McaS flhDC activator 1978249 1978258 CGUGAUGUCG nd [IEP], [SM] [9]
small regulatory RNA OxyS flhDC repressor 1978200 1978219 UUCCCACCCAGAAUAACCAA nd [IMP], [SM] [8]
small regulatory RNA OmrA flhDC repressor 1978206 1978251 CCCAGAAUAACCAACUUUAUUUUUAUGCGGUUUCACCGCACCCCGU nd [IMP], [SM] [8], [10]


Transcription unit          
Name: flhDC
Gene(s): flhC, flhD   Genome Browser M3D Gene expression COLOMBOS
Note(s): The transcription of the flhDC operon is repressed in acidic phospholipid-deficient cells, but the gadW, metE, and yeaB genes in multicopy suppress this repression through the reduction of overexpression of RpoS caused by the same mutation in the gene producing acidic phospholipid Uchiyama J, Nobue Y, Zhao H, Matsuzaki H, Nagahama H, Matsuoka S, Matsumoto K, Hara H,2010 The mechanism for this is not known.
Under motility-inducing environmental growth conditions, a motile element (IS5) is inserted into the upstream region of the flhDC operon. This event appears to enhance the expression of the operon, because motility and biofilm formation are increased Wang X, Wood TK,2011 IS5 insertion disrupts the H-NS binding site, thus preventing transcriptional repression of the operon Wang X, Wood TK,2011br>In a study where it was shown that the L-tryptophan eradicated persister cells, it was observed that the exogenous amino acid downregulated the expression of flhDC as well as other falgellar genes Li Y, Liu B, Guo J, Cong H, He S, Zhou H, Zhu F, Wang Q, Zhang L,2019.
The mRNA that contains the flhD gene has been observed mainly in the poles of the cell Kannaiah S, Livny J, Amster-Choder O,2019.
Reference(s): [1] Bertin P., et al., 1994
[3] Shin S., et al., 1995
Promoter
Name: flhDp2
+1: 1978577
Sigma Factor: Sigma54 Sigmulon
Distance from start of the gene: 380
Sequence: aacctgaatctgaggcagcacctggcacggctgggacggaagtcgctgtcgttctcaaaaTcggtggagctgcatgacaaa
                                -24         -12             +1                   
Note(s): This promoter was identified by microarray assays with a mutant σ54 strain and a σ54-overexpressing strain, and by σ54-related promoter element identification Zhao K,2010
We assigned a putative transcription start site to this promoter based on the observation that the majority of the σ54-dependent promoters, whose transcription start sites were determined experimentally, present a distance of 11 nucleotides between the transcription start site and the -12 box Barrios H,1999.
Evidence: [HIPP]
[ICWHO]
[IEP]
[IHBCE]
Reference(s): [5] Huerta AM., et al., 2003
[24] Zhao K., et al., 2010
Terminator(s)
Type: rho-independent
Sequence: ttaacgcgcgATTGGGGCAAAAAAAAGCAGCGGTACGTCGTTACCGCTGCTGGAATGTTGCGCCTcaccgtatca
Reference(s): [11] Feng CQ., et al., 2019
[12] Lesnik EA., et al., 2001
TF binding sites (TFBSs)
[MatA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd MatA repressor flhDp2 nd nd nd nd nd [GEA], [BPP] [2]


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -8.4 1978230 1978246 acatcacgggGTGCGGTGAAACCGCAtaaaaataaa
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [ICWHO] Inferred computationally without human oversight

 [TIM] Transcription initiation mapping

 [GEA] Gene expression analysis

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [SM] Site mutation

 [IMP] Inferred from mutant phenotype

 [IEP] Inferred from expression pattern

 [HIPP] Human inference of promoter position

 [IHBCE] Inferred by a human based on computational evidence


Reference(s)    

 [1] Bertin P., Terao E., Lee EH., Lejeune P., Colson C., Danchin A., Collatz E., 1994, The H-NS protein is involved in the biogenesis of flagella in Escherichia coli., J Bacteriol 176(17):5537-40

 [2] Lehti TA., Bauchart P., Dobrindt U., Korhonen TK., Westerlund-Wikstrom B., 2012, The fimbriae activator MatA switches off motility in Escherichia coli by repression of the flagellar master operon flhDC., Microbiology 158(Pt 6):1444-55

 [3] Shin S., Park C., 1995, Modulation of flagellar expression in Escherichia coli by acetyl phosphate and the osmoregulator OmpR., J Bacteriol 177(16):4696-702

 [4] Barker CS., Pruss BM., Matsumura P., 2004, Increased motility of Escherichia coli by insertion sequence element integration into the regulatory region of the flhD operon., J Bacteriol 186(22):7529-37

 [5] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [6] Soutourina O., Kolb A., Krin E., Laurent-Winter C., Rimsky S., Danchin A., Bertin P., 1999, Multiple control of flagellum biosynthesis in Escherichia coli: role of H-NS protein and the cyclic AMP-catabolite activator protein complex in transcription of the flhDC master operon., J Bacteriol 181(24):7500-8

 [7] Wei BL., Brun-Zinkernagel AM., Simecka JW., Pruss BM., Babitzke P., Romeo T., 2001, Positive regulation of motility and flhDC expression by the RNA-binding protein CsrA of Escherichia coli., Mol Microbiol 40(1):245-56

 [8] De Lay N., Gottesman S., 2012, A complex network of small non-coding RNAs regulate motility in Escherichia coli., Mol Microbiol 86(3):524-38

 [9] Thomason MK., Fontaine F., De Lay N., Storz G., 2012, A small RNA that regulates motility and biofilm formation in response to changes in nutrient availability in Escherichia coli., Mol Microbiol 84(1):17-35

 [10] Romilly C., Hoekzema M., Holmqvist E., Wagner EGH., 2020, Small RNAs OmrA and OmrB promote class III flagellar gene expression by inhibiting the synthesis of anti-Sigma factor FlgM., RNA Biol 17(6):872-880

 [11] Feng CQ., Zhang ZY., Zhu XJ., Lin Y., Chen W., Tang H., Lin H., 2019, iTerm-PseKNC: a sequence-based tool for predicting bacterial transcriptional terminators., Bioinformatics 35(9):1469-1477

 [12] Lesnik EA., Sampath R., Levene HB., Henderson TJ., McNeil JA., Ecker DJ., 2001, Prediction of rho-independent transcriptional terminators in Escherichia coli., Nucleic Acids Res 29(17):3583-94

 [13] Lehnen D., Blumer C., Polen T., Wackwitz B., Wendisch VF., Unden G., 2002, LrhA as a new transcriptional key regulator of flagella, motility and chemotaxis genes in Escherichia coli., Mol Microbiol 45(2):521-32

 [14] Amores GR., de Las Heras A., Sanches-Medeiros A., Elfick A., Silva-Rocha R., 2017, Systematic identification of novel regulatory interactions controlling biofilm formation in the bacterium Escherichia coli., Sci Rep 7(1):16768

 [15] Otsuka J., Watanabe H., Mori KT., 1996, Evolution of transcriptional regulation system through promiscuous coupling of regulatory proteins with operons; suggestion from protein sequence similarities in Escherichia coli., J Theor Biol 178(2):183-204

 [16] Kim YJ., Im SY., Lee JO., Kim OB., 2016, Potential Swimming Motility Variation by AcrR in Escherichia coli., J Microbiol Biotechnol 26(10):1824-1828

 [17] Wiebe H., Gurlebeck D., Gross J., Dreck K., Pannen D., Ewers C., Wieler LH., Schnetz K., 2015, YjjQ Represses Transcription of flhDC and Additional Loci in Escherichia coli., J Bacteriol 197(16):2713-20

 [18] Filippova EV., Zemaitaitis B., Aung T., Wolfe AJ., Anderson WF., 2018, Structural Basis for DNA Recognition by the Two-Component Response Regulator RcsB., MBio 9(1)

 [19] Francez-Charlot A., Laugel B., Van Gemert A., Dubarry N., Wiorowski F., Castani?-Cornet MP., Gutierrez C., Cam K., 2003, RcsCDB His-Asp phosphorelay system negatively regulates the flhDC operon in Escherichia coli., Mol Microbiol 49(3):823-32

 [20] Pesavento C., Hengge R., 2012, The global repressor FliZ antagonizes gene expression by σS-containing RNA polymerase due to overlapping DNA binding specificity., Nucleic Acids Res 40(11):4783-93

 [21] Stojiljkovic I., Baumler AJ., Hantke K., 1994, Fur regulon in gram-negative bacteria. Identification and characterization of new iron-regulated Escherichia coli genes by a fur titration assay., J Mol Biol 236(2):531-45

 [22] Sperandio V., Torres AG., Kaper JB., 2002, Quorum sensing Escherichia coli regulators B and C (QseBC): a novel two-component regulatory system involved in the regulation of flagella and motility by quorum sensing in E. coli., Mol Microbiol 43(3):809-21

 [23] Ko M., Park C., 2000, H-NS-Dependent regulation of flagellar synthesis is mediated by a LysR family protein., J Bacteriol 182(16):4670-2

 [24] Zhao K., Liu M., Burgess RR., 2010, Promoter and regulon analysis of nitrogen assimilation factor, sigma54, reveal alternative strategy for E. coli MG1655 flagellar biosynthesis., Nucleic Acids Res 38(4):1273-83

RegulonDB