RegulonDB RegulonDB 10.10: Operon Form
   

pitA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: pitA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: pitA
Gene(s): pitA   Genome Browser M3D Gene expression COLOMBOS
Note(s): pitA expression is not constitutive and it is positively regulated by the availability of Pi and of Zn(II) Jackson RJ,2008 Jackson et al. (2009) suggested a model in which Zn(II), as well as other divalent cations such as Mg(II) and Ca(II), are cotransported with phosphate by PitA Jackson RJ,2008
Evidence: [AISGDTU] Automated inference that a single-gene directon is a transcription unit
Promoter
Name: pitAp
+1: 3637612
Distance from start of the gene: 30
Sequence: atcaaaaaaagtctatatttcactttgcccgcgccgcgaaagtcactgataatgcgccgcGttcatgtcctcaaaatggcg
Evidence: [HTTIM]    
Reference(s): [1] Mendoza-Vargas A., et al., 2009
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd FNR activator pitAp nd nd nd nd nd [GEA], [BPP] [3]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MgrR pitA repressor 3637829 3637857 UGGGUGUUUUGCUGGGUGGUCUGAGUGUU nd [IEP], [IMP] [2]





RegulonDB