RegulonDB RegulonDB 10.8: Operon Form
   

ryeA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ryeA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: ryeA
Gene(s): ryeA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [AISDTU] Automated inference that a single-gene directon is a transcription unit
[LTED] Length of transcript experimentally determined
Reference(s): [1] Argaman L., et al., 2001
Promoter
Name: ryeAp
+1: 1923064
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 2
Sequence: cttaacaagaatgttaaaaaacgctggactcagacagtagagtgtgtgttatggttgactAtaaagtcagcgaaggaaatg
                         -35                      -10       +1                   
Note(s): Vogel et al. Vogel J,2003 mapped a transcriptional start site of this promoter 2 nt downstream of the one mapped by J. Choi et al., but it appears to be the product of a proccesed RNA Choi JS,2019.
Evidence: [HIPP]
[IMP]
[TIM]
Reference(s): [1] Argaman L., et al., 2001
[2] Choi JS., et al., 2019


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  sdsR antisense post-transcriptional regulation   1921128 1921231 TTCTTCGTTGCTCGTCTGCGTAAAACTCAGGCGATTCCCGCCTTACCCGCCCCCAAATACAAAGTCGGTAATTTTCCGTTCAGCCCGGTGAAAGATCGCGAAG [GEA]
[IMP]		 [3]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


Evidence    

 [HIPP] Human inference of promoter position

 [IMP] Inferred from mutant phenotype

 [TIM] Transcription initiation mapping


Reference(s)    

 [1] Argaman L., Hershberg R., Vogel J., Bejerano G., Wagner EG., Margalit H., Altuvia S., 2001, Novel small RNA-encoding genes in the intergenic regions of Escherichia coli., Curr Biol 11(12):941-50

 [2] Choi JS., Park H., Kim W., Lee Y., 2019, Coordinate regulation of the expression of SdsR toxin and its downstream pphA gene by RyeA antitoxin in Escherichia coli., Sci Rep 9(1):9627

 [3] Vogel J., Bartels V., Tang TH., Churakov G., Slagter-Jager JG., Huttenhofer A., Wagner EG., 2003, RNomics in Escherichia coli detects new sRNA species and indicates parallel transcriptional output in bacteria., Nucleic Acids Res 31(22):6435-43

RegulonDB