RegulonDB RegulonDB 10.8: Operon Form
   

ryeA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ryeA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: ryeA
Gene(s): ryeA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [AISDTU] Automated inference that a single-gene directon is a transcription unit
[LTED] Length of transcript experimentally determined
Reference(s): [1] Argaman L., et al., 2001
Promoter
Name: ryeAp
+1: 1923064
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 2
Sequence: cttaacaagaatgttaaaaaacgctggactcagacagtagagtgtgtgttatggttgactAtaaagtcagcgaaggaaatg
                         -35                      -10       +1                   
Note(s): Vogel et al. Vogel J,2003 mapped a transcriptional start site of this promoter 2 nt downstream of the one mapped by J. Choi et al., but it appears to be the product of a proccesed RNA Choi JS,2019.
Evidence: [HIPP]
[IMP]
[TIM]
Reference(s): [1] Argaman L., et al., 2001
[2] Choi JS., et al., 2019


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  sdsR antisense post-transcriptional regulation   1921128 1921231 TTCTTCGTTGCTCGTCTGCGTAAAACTCAGGCGATTCCCGCCTTACCCGCCCCCAAATACAAAGTCGGTAATTTTCCGTTCAGCCCGGTGAAAGATCGCGAAG [GEA]
[IMP]
[3]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"





RegulonDB