RegulonDB RegulonDB 10.8: Operon Form
   

tdk operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: tdk
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: tdk
Gene(s): tdk   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, ATTTATTGGCGGCACAAAATAAA, in the intergenic region of the divergent genes tdk and hns. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Evidence: [AISDTU] Automated inference that a single-gene directon is a transcription unit
[LTED] Length of transcript experimentally determined
Reference(s): [1] Black ME., et al., 1991


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -12.0 1293488 1293526 gataaactccAGCCAACTTTATTTCATATCATTGAGGGCCTGTGGCTGatggcacagc
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"



RegulonDB