RegulonDB RegulonDB 10.8: Operon Form
   

ddlA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ddlA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: ddlA
Gene(s): ddlA   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent
genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Evidence: [AISDTU] Automated inference that a single-gene directon is a transcription unit



RegulonDB