|
|
| Operon |  |
|---|---|
| Name: | ddlA |
| This page displays every known transcription unit of this operon and their known regulation. | |
| Name: | ddlA |
| Gene(s): | ddlA Genome Browser M3D Gene expression COLOMBOS |
| Note(s): | J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions. |
| Evidence: | [AISDTU] Automated inference that a single-gene directon is a transcription unit |