RegulonDB RegulonDB 10.8: Operon Form

ompW operon and associated TUs in Escherichia coli K-12 genome

Name: ompW
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit          
Name: ompW
Gene(s): ompW   Genome Browser M3D Gene expression COLOMBOS
Note(s): The ompW gene is regulated by temperature at the transcriptional regulation level, and it is positively controlled by both H-NS and StpA transcriptional regulation, which were identified by single (hns or & stpA) and double (hns-stpA) mutants 24444297 ompW expression is reduced under iron limitation Zhang P,2019.
Evidence: [AISDTU] Automated inference that a single-gene directon is a transcription unit
Name: ompWp
+1: 1313991
Distance from start of the gene: 29
Sequence: tcatatgtaatgtgatctatgtaggatcatttgttactccaatgtaggtatattcgtcacGtttttataaccataacgacg
Evidence: [CV(RS-EPT-CBR/TA)]
Reference(s): [1] Mendoza-Vargas A., et al., 2009
[2] Salgado H, et al., 2012
[3] Xiao M., et al., 2016
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArcA-Phosphorylated repressor ompWp 1313983 1314001 1.5 tgtaggtataTTCGTCACGTTTTTATAACcataacgacg nd [AIBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [3], [10]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cAMP repressor ompWp 1313941 1313957 -42.5 tcatatgtaaTGTGATCTATGTAGGATcatttgttac nd [AIBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [3], [6], [7]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR1 activator ompWp 1313903 1313916 -81.5 aacttctaaaTTAATCCAGATCAAtaaagggtga nd [AIBSCS], [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [3], [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote FNR repressor ompWp 1313858 1313871 -126.5 tatttaaaaaTTGATTTAAATCACattaaccagg nd [AIBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [3], [4]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd Fur-Fe2+ activator ompWp nd nd nd nd nd [GEA] [11]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NarL-Phosphorylated repressor ompWp 1313965 1313981 -18.5 gatcatttgtTACTCCAATGTAGGTATattcgtcacg nd [AIBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [3], [8], [9]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd SoxS repressor ompWp nd nd nd nd nd [GEA] [11]
Note(s): 1By making use of microarray analyses, Constantinidou et al. Constantinidou C,2006 concluded that FNR activates ompW gene expression. They also identified a putative FNR-binding site upstream of the gene, but the sequence was not shown.2By making use of microarray analyses, Constantinidou et al. Constantinidou C,2006 concluded that FNR activates ompW gene expression. They also identified a putative FNR-binding site upstream of the gene, but the sequence was not shown.

Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  rybB antisense translational regulation repressor 1314007 1314039 GACGGAGCGGATATGAAAAAGTTAACAGTGGC [GEA]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


 [1] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Xiao M., Lai Y., Sun J., Chen G., Yan A., 2016, Transcriptional Regulation of the Outer Membrane Porin Gene ompW Reveals its Physiological Role during the Transition from the Aerobic to the Anaerobic Lifestyle of Escherichia coli., Front Microbiol 7:799

 [4] Myers KS., Yan H., Ong IM., Chung D., Liang K., Tran F., Keles S., Landick R., Kiley PJ., 2013, Genome-scale analysis of escherichia coli FNR reveals complex features of transcription factor binding., PLoS Genet 9(6):e1003565

 [5] Constantinidou C., Hobman JL., Griffiths L., Patel MD., Penn CW., Cole JA., Overton TW., 2006, A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth., J Biol Chem 281(8):4802-15

 [6] Gaston K., Bell A., Kolb A., Buc H., Busby S., 1990, Stringent spacing requirements for transcription activation by CRP., Cell 62(4):733-43

 [7] Ushida C., Aiba H., 1990, Helical phase dependent action of CRP: effect of the distance between the CRP site and the -35 region on promoter activity., Nucleic Acids Res 18(21):6325-30

 [8] Tyson KL., Bell AI., Cole JA., Busby SJ., 1993, Definition of nitrite and nitrate response elements at the anaerobically inducible Escherichia coli nirB promoter: interactions between FNR and NarL., Mol Microbiol 7(1):151-7

 [9] Tyson KL., Cole JA., Busby SJ., 1994, Nitrite and nitrate regulation at the promoters of two Escherichia coli operons encoding nitrite reductase: identification of common target heptamers for both NarP- and NarL-dependent regulation., Mol Microbiol 13(6):1045-55

 [10] Park DM., Akhtar MS., Ansari AZ., Landick R., Kiley PJ., 2013, The bacterial response regulator ArcA uses a diverse binding site architecture to regulate carbon oxidation globally., PLoS Genet 9(10):e1003839

 [11] Zhang P., Ye Z., Ye C., Zou H., Gao Z., Pan J., 2019, OmpW is positively regulated by iron via Fur, and negatively regulated by SoxS contribution to oxidative stress resistance in Escherichia coli., Microb Pathog 138:103808

 [12] Johansen J., Rasmussen AA., Overgaard M., Valentin-Hansen P., 2006, Conserved small non-coding RNAs that belong to the sigmaE regulon: role in down-regulation of outer membrane proteins., J Mol Biol 364(1):1-8
