RegulonDB RegulonDB 11.1: Operon Form
   

ompW operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ompW
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ompW
Gene(s): ompW   Genome Browser M3D Gene expression COLOMBOS
Note(s): The ompW gene is regulated by temperature at the transcriptional regulation level, and it is positively controlled by both H-NS and StpA transcriptional regulation, which were identified by single (hns or & stpA) and double (hns-stpA) mutants Brambilla L, Morán-Barrio J, Viale AM,2014 ompW expression is reduced under iron limitation Zhang P,2019.
The ompW gene is upregulated by long-term (8 to 12 h) exposure of E. coli to some biocides Merchel Piovesan Pereira B, Wang X, Tagkopoulos I,2020.
Evidence: [COMP-AINF-SINGLE-DIRECTON] Automated inference that a single-gene directon is a transcription unit
Promoter
Name: ompWp
+1: 1313991
Distance from start of the gene: 29
Sequence: tcatatgtaatgtgatctatgtaggatcatttgttactccaatgtaggtatattcgtcacGtttttataaccataacgacg
Evidence: [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[RS-EPT-CBR]
Reference(s): [1] Mendoza-Vargas A., et al., 2009
[2] Salgado H, et al., 2012
[3] Xiao M., et al., 2016
TF binding sites (TFBSs)
[ArcA,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal ArcA-phosphorylated repressor ompWp 1313983 1314001 1.5 tgtaggtataTTCGTCACGTTTTTATAACcataacgacg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3]
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP repressor ompWp 1313941 1313957 -42.5 tcatatgtaaTGTGATCTATGTAGGATcatttgttac nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3]
[FNR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR activator ompWp 1313903 1313916 -81.5 aacttctaaaTTAATCCAGATCAAtaaagggtga nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3], [7]
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote FNR repressor ompWp 1313858 1313871 -126.5 tatttaaaaaTTGATTTAAATCACattaaccagg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3]
[Fur,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd Fur-Fe2+ activator ompWp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [8]
[NarL,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NarL-phosphorylated repressor ompWp 1313965 1313981 -18.5 gatcatttgtTACTCCAATGTAGGTATattcgtcacg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [3]
[SoxS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd SoxS repressor ompWp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [8]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA RybB ompW repressor 1314007 1314039 CGACGGAGCGGAUAUGAAAAAGUUAACAGUGGC nd [AS-HYPO], [EXP-IEP], [EXP-IPI] [4], [5]
small regulatory RNA MicA ompW repressor 1314013 1314045 AGCGGAUAUGAAAAAGUUAACAGUGGCGGCUUU nd [EXP-IEP] [6]


Evidence    

 [EXP-IDA-HPT-TRANSCR-INIT-M-RACE-MAP] High-throughput transcription initiation mapping

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [AS-HYPO] Author hypothesis

 [EXP-IEP] Inferred from expression pattern

 [EXP-IPI] Inferred from physical interaction


Reference(s)    

 [1] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Xiao M., Lai Y., Sun J., Chen G., Yan A., 2016, Transcriptional Regulation of the Outer Membrane Porin Gene ompW Reveals its Physiological Role during the Transition from the Aerobic to the Anaerobic Lifestyle of Escherichia coli., Front Microbiol 7:799

 [4] Johansen J., Rasmussen AA., Overgaard M., Valentin-Hansen P., 2006, Conserved small non-coding RNAs that belong to the sigmaE regulon: role in down-regulation of outer membrane proteins., J Mol Biol 364(1):1-8

 [5] Lalaouna D., Carrier MC., Semsey S., Brouard JS., Wang J., Wade JT., Masse E., 2015, A 3' external transcribed spacer in a tRNA transcript acts as a sponge for small RNAs to prevent transcriptional noise., Mol Cell 58(3):393-405

 [6] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

 [7] Constantinidou C., Hobman JL., Griffiths L., Patel MD., Penn CW., Cole JA., Overton TW., 2006, A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth., J Biol Chem 281(8):4802-15

 [8] Zhang P., Ye Z., Ye C., Zou H., Gao Z., Pan J., 2019, OmpW is positively regulated by iron via Fur, and negatively regulated by SoxS contribution to oxidative stress resistance in Escherichia coli., Microb Pathog 138:103808

RegulonDB