RegulonDB RegulonDB 10.8: Operon Form
   

sstT operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: sstT
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: sstT
Gene(s): sstT   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: sstTp
+1: 3239863
Distance from start of the gene: 81
Sequence: ctctttaaaatccagcatttttcgcttcccgaagctgtaactttccttatactcgaccttGcaaacactttgttacatcct
Evidence: [CV(RS-EPT-CBR)]
[HTIM]
[RS-EPT-CBR]
Reference(s): [1] Mendoza-Vargas A., et al., 2009
[2] Salgado H, et al., 2012


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  gcvB antisense post-transcriptional regulation repressor 3239918 3239944 GACAACACAATGAAAGGATCGAAAAA
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -6.5 3239737 3239763 atcagtctggAAGCCGCACGTTGGCTTTATTTTTATgtcaaagaaa
  anti-terminator -8.4 3239706 3239743 gggactgaccGAGTCCTTTTTTGATGTTGTCATCAGTCTGGAAGCCGcacgttggct
  anti-anti-terminator -22.69 3239648 3239711 tttcgcaccgATGCTGGCCTGTTCCCCTCACCCTAACCCTCTCCCCAAACGGGGCGAGGGGACTGACCGAGTCcttttttgat
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"





RegulonDB