RegulonDB

RegulonDB RegulonDB 10.8: Operon Form

sstT operon and associated TUs in Escherichia coli K-12 genome

Operon
Name:	sstT
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit

Name:	sstT
Gene(s):	sstT Genome Browser M3D Gene expression COLOMBOS
Evidence:	[ICWHO] Inferred computationally without human oversight
Promoter
Name:	sstTp
+1:	3239863
Distance from start of the gene:	81
Sequence:	ctctttaaaatccagcatttttcgcttcccgaagctgtaactttccttatactcgaccttGcaaacactttgttacatcct
Evidence:	[CV(RS-EPT-CBR)] [HTIM] [RS-EPT-CBR]
Reference(s):	[1] Mendoza-Vargas A., et al., 2009 [2] Salgado H, et al., 2012

Regulation by sRNA

	Small RNA name (Regulator)	Regulation type	Mechanism	Function	Binding Sites			Evidence	Reference
	Small RNA name (Regulator)	Regulation type	Mechanism	Function	LeftPos	RightPos	Sequence (RNA-strand)	Evidence	Reference
	gcvB	antisense	post-transcriptional regulation	repressor	3239918	3239944	GACAACACAATGAAAGGATCGAAAAA

Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"

RNA cis-regulatory element

Regulation, transcriptional elongation
Attenuator type:	Transcriptional
Strand:	forward

Structure type	Energy	LeftPos	RightPos	Sequence (RNA-strand)
terminator	-6.5	3239737	3239763	atcagtctggAAGCCGCACGTTGGCTTTATTTTTATgtcaaagaaa
anti-terminator	-8.4	3239706	3239743	gggactgaccGAGTCCTTTTTTGATGTTGTCATCAGTCTGGAAGCCGcacgttggct
anti-anti-terminator	-22.69	3239648	3239711	tttcgcaccgATGCTGGCCTGTTCCCCTCACCCTAACCCTCTCCCCAAACGGGGCGAGGGGACTGACCGAGTCcttttttgat

Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"

Evidence
[CV(RS-EPT-CBR)] cross validation(RS-EPT-CBR)
[HTIM] High-throughput transcription initiation mapping
[RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

Reference(s)
[1] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526
[2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

Reference(s)

[1] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

[2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

RegulonDB