RegulonDB RegulonDB 10.10: Operon Form
   

ecnAB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ecnAB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ecnB
Gene(s): ecnB   Genome Browser M3D Gene expression COLOMBOS
Evidence: [BTEI] Boundaries of transcription experimentally identified
[LTED] Length of transcript experimentally determined
Reference(s): [1] Bishop RE., et al., 1998
Promoter
Name: ecnBp
+1: 4376509
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 44
Sequence: ttctcttccgaaaaatcatcagattcccatcatttttggcgatgttgtctattattaattTgctataggcaaacataaata
                         -35                 -10            +1                   
Evidence: [ICWHO]
[IEP]
[IHBCE]
[TIM]
Reference(s): [1] Bishop RE., et al., 1998
[2] Huerta AM., et al., 2003
Terminator(s)
Type: rho-independent
Sequence: aataagcaatAACGGTACGACAGCTGTGTCGTGCCGTttgttttttc
Reference(s): [1] Bishop RE., et al., 1998
TF binding sites (TFBSs)
[OmpR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal OmpR-phosphorylated repressor ecnBp 4376517 4376536 18.5 tttgctatagGCAAACATAAATAACATTACctaaaaggaa nd [APIORCISFBSCS] [1]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA ecnB repressor 4376542 4376572 AGGAAGACGUUAUGGUGAAGAAGACAAUUGC nd [IEP] [3]


Transcription unit       
Name: ecnAB
Gene(s): ecnA, ecnB   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Translational
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -21.3 4376270 4376301 agtaatgcggTTGTGGTGCGGCCTGCAGGCTGCACCATCACttattcaggt
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [ICWHO] Inferred computationally without human oversight

 [IEP] Inferred from expression pattern

 [IHBCE] Inferred by a human based on computational evidence

 [TIM] Transcription initiation mapping

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.


Reference(s)    

 [1] Bishop RE., Leskiw BK., Hodges RS., Kay CM., Weiner JH., 1998, The entericidin locus of Escherichia coli and its implications for programmed bacterial cell death., J Mol Biol 280(4):583-96

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

RegulonDB