RegulonDB RegulonDB 10.8: Operon Form
   

eutSPQTDM operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: eutSPQTDM
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Gene(s): eutM, eutD, eutT, eutQ, eutP, eutS   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, GTTATTTACTCTGACGAAAAATT, in the upstream region of the eutS gene. The demonstration was based on different statistical methods Oberto J.,2010
Evidence: [ICWHO] Inferred computationally without human oversight



RegulonDB