![]() ![]() ![]() |
Name: | eutSPQTDM |
Gene(s): | eutM, eutD, eutT, eutQ, eutP, eutS Genome Browser M3D Gene expression COLOMBOS |
Note(s): | J. Oberto in 2010 identified a possible binding site for NagC, GTTATTTACTCTGACGAAAAATT, in the upstream region of the eutS gene. The demonstration was based on different statistical methods Oberto J.,2010 |
Evidence: | [ICWHO] Inferred computationally without human oversight |