|
|
| Operon |  |
|---|---|
| Name: | eutSPQTDM |
| This page displays every known transcription unit of this operon and their known regulation. | |
| Gene(s): | eutM, eutD, eutT, eutQ, eutP, eutS Genome Browser M3D Gene expression COLOMBOS |
| Note(s): | J. Oberto in 2010 identified a possible binding site for NagC, GTTATTTACTCTGACGAAAAATT, in the upstream region of the eutS gene. The demonstration was based on different statistical methods Oberto J.,2010 |
| Evidence: | [ICWHO] Inferred computationally without human oversight |