RegulonDB RegulonDB 10.8: Operon Form
   

yobA-yebZY operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: yobA-yebZY
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Gene(s): yebY, yebZ, yobA   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  fnrS antisense post-transcriptional regulation repressor 1924952 1924986 AAAAAGGAATAGATAATATGGCTTCAACTGCACG [IMP] [1]
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"



RegulonDB