RegulonDB RegulonDB 10.8: Operon Form
   

iraP operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: iraP
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: iraP
Gene(s): iraP   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region
of the divergent genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Evidence: [ICWHO] Inferred computationally without human oversight
[LTED] Length of transcript experimentally determined
Reference(s): [1] Bougdour A., et al., 2007
Promoter
Name: iraPp1
+1: 401319
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 67
Sequence: gctggtaatcaaacaaaaaatatttgcgcaaagtatttcctttgtcataaaaataatactTccagacactatgaagttgtg
                         -35                        -10     +1                   
Note(s): iraPp, which is sensed by SpoT but not RelA, is a phosphate starvation-induced promoter, and ppGpp is required for its full induction. A discriminatory region of the iraPp promoter is necessary for its ppGpp-mediated induction Bougdour A,2007.
Evidence: [CV(RS-EPT-CBR)]
[CV(TIM)]
[NAS]
[RS-EPT-CBR]
[TIM]
Reference(s): [1] Bougdour A., et al., 2007
[2] Salgado H, et al., 2012
[3] Tu X., et al., 2006
TF binding sites (TFBSs)
[CsgD,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd CsgD activator iraPp1 nd nd nd nd nd [GEA] [4], [5]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  DksA-ppGpp activation iraPp1 DksA-ppGpp activate the iraP promoter, improving σS stability Girard ME,2018 On the other hand, DksA-ppGpp can increase iraP expression indirectly by another mechanism, possibly by reducing rRNA transcription and thereby increasing RNAP availability Girard ME,2018 [APPH]
[GEA] 		[1]
[6]
[7]
  ppGpp activation iraPp1   [GEA]
[IMP] 		[1]
Evidence: [APPH] Assay of protein purified to homogeneity
[GEA] Gene expression analysis
[IMP] Inferred from mutant phenotype
Reference(s): [1] Bougdour A., et al., 2007
[6] Girard ME., et al., 2018
[7] Ross W., et al., 2016


Transcription unit       
Name: iraP
Gene(s): iraP   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent
genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: iraPp2
+1: 401363
Distance from start of the gene: 23
Sequence: tcataaaaataatacttccagacactatgaagttgtgaaacataatgttaacttctccatActttggataaggaaatacag
Evidence: [CV(RS-EPT-CBR)]
[HTIM]
[RS-EPT-CBR]
Reference(s): [8] Mendoza-Vargas A., et al., 2009
[2] Salgado H, et al., 2012


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: forward
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -6.0 401214 401240 taattaaaagCCTATATTTTGTGTGGGTAATTATTTaaataagaga
  anti-terminator -4.5 401193 401222 tttatttataATAAAGGTTGATAATTAAAAGCCTATATTttgtgtgggt
  anti-anti-terminator -5.2 401179 401203 tatatttcatAACTTTTATTTATAATAAAGGTTGataattaaaa
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [CV(RS-EPT-CBR)] cross validation(RS-EPT-CBR)

 [CV(TIM)] cross validation(TIM)

 [NAS] Non-traceable author statement

 [RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates

 [TIM] Transcription initiation mapping

 [GEA] Gene expression analysis

 [HTIM] High-throughput transcription initiation mapping


Reference(s)    

 [1] Bougdour A., Gottesman S., 2007, ppGpp regulation of RpoS degradation via anti-adaptor protein IraP., Proc Natl Acad Sci U S A 104(31):12896-901

 [2] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.

 [3] Tu X., Latifi T., Bougdour A., Gottesman S., Groisman EA., 2006, The PhoP/PhoQ two-component system stabilizes the alternative sigma factor RpoS in Salmonella enterica., Proc Natl Acad Sci U S A 103(36):13503-8

 [4] Brombacher E., Baratto A., Dorel C., Landini P., 2006, Gene expression regulation by the Curli activator CsgD protein: modulation of cellulose biosynthesis and control of negative determinants for microbial adhesion., J Bacteriol 188(6):2027-37

 [5] Gualdi L., Tagliabue L., Landini P., 2007, Biofilm formation-gene expression relay system in Escherichia coli: modulation of sigmaS-dependent gene expression by the CsgD regulatory protein via sigmaS protein stabilization., J Bacteriol 189(22):8034-43

 [6] Girard ME., Gopalkrishnan S., Grace ED., Halliday JA., Gourse RL., Herman C., 2018, DksA and ppGpp Regulate the σS Stress Response by Activating Promoters for the Small RNA DsrA and the Anti-Adapter Protein IraP., J Bacteriol 200(2)

 [7] Ross W., Sanchez-Vazquez P., Chen AY., Lee JH., Burgos HL., Gourse RL., 2016, ppGpp Binding to a Site at the RNAP-DksA Interface Accounts for Its Dramatic Effects on Transcription Initiation during the Stringent Response., Mol Cell 62(6):811-823

 [8] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

RegulonDB