![]() ![]() ![]() ![]() |
Name: | iraP |
Gene(s): | iraP Genome Browser M3D Gene expression COLOMBOS |
Note(s): | iraP gene expression is upregulated upon L-valine addition (isoleucine starvation) in the cellular growth medium Gummesson B, Shah SA, Borum AS, Fessler M, Mitarai N, Sørensen MA, Svenningsen SL,2020. J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions. |
Evidence: | [ICWHO] Inferred computationally without human oversight [LTED] Length of transcript experimentally determined |
Reference(s): | [1] Bougdour A., et al., 2007 |
Promoter | |
Name: | iraPp1 |
+1: | 401319 |
Sigma Factor: | Sigma70 Sigmulon |
Distance from start of the gene: | 67 |
Sequence: |
gctggtaatcaaacaaaaaatatttgcgcaaagtatttcctttgtcataaaaataatactTccagacactatgaagttgtg -35 -10 +1 |
Note(s): | iraPp, which is sensed by SpoT but not RelA, is a phosphate starvation-induced promoter, and ppGpp is required for its full induction. A discriminatory region of the iraPp promoter is necessary for its ppGpp-mediated induction Bougdour A,2007. |
Evidence: |
[ICWHO] [IHBCE] [NTAS] [RS-EPT-CBR] [TIM] |
Reference(s): |
[1] Bougdour A., et al., 2007 [2] Huerta AM., et al., 2003 [3] Salgado H, et al., 2012 [4] Tu X., et al., 2006 |
Evidence: |
[APPH] Assay of protein purified to homogeneity [GEA] Gene expression analysis [IMP] Inferred from mutant phenotype |
Reference(s): |
[1] Bougdour A., et al., 2007 [7] Girard ME., et al., 2018 [8] Ross W., et al., 2016 |
Name: | iraP |
Gene(s): | iraP Genome Browser M3D Gene expression COLOMBOS |
Note(s): | iraP gene expression is upregulated upon L-valine addition (isoleucine starvation) in the cellular growth medium Gummesson B, Shah SA, Borum AS, Fessler M, Mitarai N, Sørensen MA, Svenningsen SL,2020. J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions. |
Evidence: | [ICWHO] Inferred computationally without human oversight |
Promoter | |
Name: | iraPp2 |
+1: | 401363 |
Distance from start of the gene: | 23 |
Sequence: |
tcataaaaataatacttccagacactatgaagttgtgaaacataatgttaacttctccatActttggataaggaaatacag |
Evidence: |
[HTTIM] ![]() ![]() [RS-EPT-CBR] |
Reference(s): |
[9] Mendoza-Vargas A., et al., 2009 [3] Salgado H, et al., 2012 |
RNA cis-regulatory element | ![]() |
---|
Regulation, transcriptional elongation | |
Attenuator type: | Transcriptional |
Strand: | forward |
Evidence: | [ICA] Inferred by computational analysis |
Reference(s): | [10] Merino E, et al., 2005 |
Structure type | Energy | LeftPos | RightPos | Sequence (RNA-strand) | |
---|---|---|---|---|---|
terminator | -6.0 | 401214 | 401240 | taattaaaagCCTATATTTTGTGTGGGTAATTATTTaaataagaga | |
anti-terminator | -4.5 | 401193 | 401222 | tttatttataATAAAGGTTGATAATTAAAAGCCTATATTttgtgtgggt | |
anti-anti-terminator | -5.2 | 401179 | 401203 | tatatttcatAACTTTTATTTATAATAAAGGTTGataattaaaa |
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos" |
Reference(s) |
![]() |
---|---|