![]() ![]() ![]() ![]() |
Name: | iraP |
Gene(s): | iraP Genome Browser M3D Gene expression COLOMBOS |
Note(s): | J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions. |
Evidence: | [ICWHO] Inferred computationally without human oversight [LTED] Length of transcript experimentally determined |
Reference(s): | [1] Bougdour A., et al., 2007 |
Promoter | |
Name: | iraPp1 |
+1: | 401319 |
Sigma Factor: | Sigma70 Sigmulon |
Distance from start of the gene: | 67 |
Sequence: |
gctggtaatcaaacaaaaaatatttgcgcaaagtatttcctttgtcataaaaataatactTccagacactatgaagttgtg -35 -10 +1 |
Note(s): | iraPp, which is sensed by SpoT but not RelA, is a phosphate starvation-induced promoter, and ppGpp is required for its full induction. A discriminatory region of the iraPp promoter is necessary for its ppGpp-mediated induction Bougdour A,2007. |
Evidence: |
[CV(RS-EPT-CBR)] [CV(TIM)] [NAS] [RS-EPT-CBR] [TIM] |
Reference(s): |
[1] Bougdour A., et al., 2007 [2] Salgado H, et al., 2012 [3] Tu X., et al., 2006 |
Allosteric regulation of RNA-polymerase |
Regulator | Function | Promoter target of RNApol | Growth Conditions | Note | Evidence | Reference | |
---|---|---|---|---|---|---|---|
DksA-ppGpp | activation | iraPp1 | DksA-ppGpp activate the iraP promoter, improving σS stability Girard ME,2018 On the other hand, DksA-ppGpp can increase iraP expression indirectly by another mechanism, possibly by reducing rRNA transcription and thereby increasing RNAP availability Girard ME,2018 |
[APPH] [GEA] |
[1] [6] [7] |
||
ppGpp | activation | iraPp1 |
[GEA] [IMP] |
[1] |
Evidence: |
[APPH] Assay of protein purified to homogeneity [GEA] Gene expression analysis [IMP] Inferred from mutant phenotype |
Reference(s): |
[1] Bougdour A., et al., 2007 [6] Girard ME., et al., 2018 [7] Ross W., et al., 2016 |
Name: | iraP |
Gene(s): | iraP Genome Browser M3D Gene expression COLOMBOS |
Note(s): | J. Oberto in 2010 identified a possible binding site for NagC, AATAATTACCCACACAAAATATA, in the intergenic region of the divergent genes iraP and ddlA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions. |
Evidence: | [ICWHO] Inferred computationally without human oversight |
Promoter | |
Name: | iraPp2 |
+1: | 401363 |
Distance from start of the gene: | 23 |
Sequence: |
tcataaaaataatacttccagacactatgaagttgtgaaacataatgttaacttctccatActttggataaggaaatacag |
Evidence: |
[CV(RS-EPT-CBR)] [HTIM] [RS-EPT-CBR] |
Reference(s): |
[8] Mendoza-Vargas A., et al., 2009 [2] Salgado H, et al., 2012 |
RNA cis-regulatory element | ![]() |
---|
Regulation, transcriptional elongation | |
Attenuator type: | Transcriptional |
Strand: | forward |
Structure type | Energy | LeftPos | RightPos | Sequence (RNA-strand) | |
---|---|---|---|---|---|
terminator | -6.0 | 401214 | 401240 | taattaaaagCCTATATTTTGTGTGGGTAATTATTTaaataagaga | |
anti-terminator | -4.5 | 401193 | 401222 | tttatttataATAAAGGTTGATAATTAAAAGCCTATATTttgtgtgggt | |
anti-anti-terminator | -5.2 | 401179 | 401203 | tatatttcatAACTTTTATTTATAATAAAGGTTGataattaaaa |
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos" |
Reference(s) |
![]() |
---|---|