RegulonDB

RegulonDB RegulonDB 11.2: Operon Form

fldA-uof-fur operon and associated TUs in Escherichia coli K-12 genome

Operon
Name:	fldA-uof-fur
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit

Name:	fur
Synonym(s):	OP00163
Gene(s):	fur Genome Browser M3D Gene expression COLOMBOS
Note(s):	The expression of the fur gene was increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutant for the transcriptional regulator Fnr. However, it is unknown if the effects of the transcriptional regulator act directly on gene expression; also, it is unknown which of the four promoters that transcribe the gene could be regulated by the regulator Kumar R,2011 Direct activation of fur transcription by Crl is not likely, inasmuch as fur is transcribed via σ⁷⁰ and Crl only transcribes genes dependent on σ^S Wiebe H,2015 Based on molecular analysis, an interaction between Crl and Fur proteins is suggested; both activate the expression of fur Wiebe H,2015
Evidence:	[EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s):	[1] De Lorenzo V., et al., 1988 [2] Perez-Martin J., et al., 1993 [3] Schaffer S., et al., 1985
Promoter
Name:	furpa
+1:	710716
Sigma Factor:	Sigma70 Sigmulon
Distance from start of the gene:	70
Sequence:	acaatatttgccagggacttgtggttttcatttaggcgtggcaattctataatgatacgcAttatctcaagagcaaattct -35 -10 +1
Evidence:	[COMP-AINF] [COMP-HINF] [COMP-HINF-POSITIONAL-IDENTIFICATION] [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] [RS-EPT-CBR]
Reference(s):	[1] De Lorenzo V., et al., 1988 [4] Huerta AM., et al., 2003 [5] Salgado H, et al., 2012
Terminator(s)
Type:	rho-independent
Sequence:	aacaaataagTGAGAGCTGTAACTCTCgcttttctta
Reference(s):	[3] Schaffer S., et al., 1985
Type:	rho-independent
Sequence:	tgcataaaaaAGCCAACCCGCAGGTTGGCttttctcgtt

TF binding sites (TFBSs)

[CRP,+] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	CRP-cyclic-AMP	activator	furpa	710783	710804	-77.5	ttgccgttgtAAATGTAAGCTGTGCCACGTTTttattaacaa	nd	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IMP-SITE-MUTATION]	nd	[1]

[Fur,-] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	Fur-Fe²⁺	repressor	furpa	710708	710726	-1.0	gcaattctatAATGATACGCATTATCTCAagagcaaatt	nd	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	nd	[6]
proximal	Fur-Fe²⁺	repressor	furpa	710714	710732	-7.0	ggcgtggcaaTTCTATAATGATACGCATTatctcaagag	nd	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	nd	[1], [6], [7]

Transcription factor	Function	Promoter	Binding Sites	Evidence (Confirmed, Strong, Weak)	Reference(s)
CRP-cyclic-AMP	activator	furpa	710783	710804	-77.5	ttgccgttgtAAATGTAAGCTGTGCCACGTTTttattaacaa	nd	[1]
Fur-Fe²⁺	repressor	furpa	710714	710732	-7.0	ggcgtggcaaTTCTATAATGATACGCATTatctcaagag	nd	[1], [6], [7]
Fur-Fe²⁺	repressor	furpa	710708	710726	-1.0	gcaattctatAATGATACGCATTATCTCAagagcaaatt	nd	[6]

Transcription unit

Name:	fur
Gene(s):	fur Genome Browser M3D Gene expression COLOMBOS
Note(s):	The expression of the fur gene was increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutant for the transcriptional regulator Fnr. However, it is unknown if the effects of the transcriptional regulator act directly on gene expression; also, it is unknown which of the four promoters that transcribe the gene could be regulated by the regulator Kumar R,2011
Evidence:	[EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s):	[1] De Lorenzo V., et al., 1988 [2] Perez-Martin J., et al., 1993 [3] Schaffer S., et al., 1985
Promoter
Name:	furpb
+1:	710723
Sigma Factor:	Sigma70 Sigmulon
Distance from start of the gene:	77
Sequence:	tttattaacaatatttgccagggacttgtggttttcatttaggcgtggcaattctataatGatacgcattatctcaagagc -35 +10
Evidence:	[COMP-AINF] [COMP-HINF] [COMP-HINF-POSITIONAL-IDENTIFICATION] [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] [RS-EPT-CBR]
Reference(s):	[1] De Lorenzo V., et al., 1988 [4] Huerta AM., et al., 2003 [5] Salgado H, et al., 2012
Terminator(s)
Type:	rho-independent
Sequence:	aacaaataagTGAGAGCTGTAACTCTCgcttttctta
Reference(s):	[3] Schaffer S., et al., 1985
Type:	rho-independent
Sequence:	tgcataaaaaAGCCAACCCGCAGGTTGGCttttctcgtt

TF binding sites (TFBSs)

[CRP,+] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	CRP-cyclic-AMP	activator	furpb	710783	710804	-70.5	ttgccgttgtAAATGTAAGCTGTGCCACGTTTttattaacaa	nd	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IMP-SITE-MUTATION]	nd	[1]

[Fur,-] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	Fur-Fe²⁺	repressor	furpb	710708	710726	7.0	gcaattctatAATGATACGCATTATCTCAagagcaaatt	nd	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	nd	[6]
proximal	Fur-Fe²⁺	repressor	furpb	710714	710732	1.0	ggcgtggcaaTTCTATAATGATACGCATTatctcaagag	nd	[COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	nd	[1], [6], [7]

Transcription factor	Function	Promoter	Binding Sites	Evidence (Confirmed, Strong, Weak)	Reference(s)
CRP-cyclic-AMP	activator	furpb	710783	710804	-70.5	ttgccgttgtAAATGTAAGCTGTGCCACGTTTttattaacaa	nd	[1]
Fur-Fe²⁺	repressor	furpb	710714	710732	1.0	ggcgtggcaaTTCTATAATGATACGCATTatctcaagag	nd	[1], [6], [7]
Fur-Fe²⁺	repressor	furpb	710708	710726	7.0	gcaattctatAATGATACGCATTATCTCAagagcaaatt	nd	[6]

Transcription unit

Name:	uof-fur
Gene(s):	fur, uof Genome Browser M3D Gene expression COLOMBOS
Evidence:	[EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
Reference(s):	[2] Perez-Martin J., et al., 1993 [3] Schaffer S., et al., 1985 [8] Zheng M., et al., 1999
Promoter
Name:	uofp
+1:	710829
Distance from start of the gene:	104
Sequence:	gccaatcaaaataattgctacaaatttgtaacttttgctgttgtacctgtacaatgtcccGgtgttcaagtggccttgccg
Evidence:	[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s):	[8] Zheng M., et al., 1999
Terminator(s)
Type:	rho-independent
Sequence:	aacaaataagTGAGAGCTGTAACTCTCgcttttctta
Reference(s):	[3] Schaffer S., et al., 1985
Type:	rho-independent
Sequence:	tgcataaaaaAGCCAACCCGCAGGTTGGCttttctcgtt

TF binding sites (TFBSs)

[OxyR,+] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	OxyR	activator	uofp	710861	710877	-40.0	caatcaaaatAATTGCTACAAATTTGTaacttttgct	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[8]
proximal	OxyR	activator	uofp	710883	710899	-62.0	acgccgtattAATAGATAATGCCAATCaaaataattg	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO-MANUAL], [EXP-DAP-SEQ], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[8], [10]

[SoxS,+] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	SoxS	activator	uofp	710881	710900	-61.5	tacgccgtatTAATAGATAATGCCAATCAAaataattgct	nd	[EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[8], [10]

Transcription factor	Function	Promoter	Binding Sites	Evidence (Confirmed, Strong, Weak)	Reference(s)
OxyR	activator	uofp	710883	710899	-62.0	acgccgtattAATAGATAATGCCAATCaaaataattg	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ]	[8], [10]
SoxS	activator	uofp	710881	710900	-61.5	tacgccgtatTAATAGATAATGCCAATCAAaataattgct	[EXP-IEP-RNA-SEQ]	[8], [10]
OxyR	activator	uofp	710861	710877	-40.0	caatcaaaatAATTGCTACAAATTTGTaacttttgct	[EXP-IEP-GENE-EXPRESSION-ANALYSIS]	[8]

sRNA Interaction TU

sRNA	TU Regulated	Function	Binding Sites			Regulatory Mechanism	Evidence (Confirmed, Strong, Weak)	Reference(s)
sRNA	TU Regulated	Function	PosLeft	PosRight	Target sequence (mRNA)	Regulatory Mechanism	Evidence (Confirmed, Strong, Weak)	Reference(s)
small regulatory RNA RyhB	uof-fur	repressor	710693	710742	GACAGAAUUUGCUCUUGAGAUAAUGCGUAUCAUUAUAGAAUUGCCACGCC	TRANSLATION-BLOCKING	[EXP-IEP], [EXP-IMP-SITE-MUTATION]	[9]

Transcription unit

Name:	fldA-uof-fur
Synonym(s):	fldA-fur
Gene(s):	fur, uof, fldA Genome Browser M3D Gene expression COLOMBOS
Evidence:	[EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s):	[8] Zheng M., et al., 1999
Promoter
Name:	fldAp
+1:	711521
Distance from start of the gene:	56
Sequence:	tgtgcagtcctgctcgtttgctgattccgcaagactgcctgttctgctatgattgcctttAtccgtgggcaattttccacc
Evidence:	[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s):	[8] Zheng M., et al., 1999
Terminator(s)
Type:	rho-independent
Sequence:	aacaaataagTGAGAGCTGTAACTCTCgcttttctta
Reference(s):	[3] Schaffer S., et al., 1985
Type:	rho-independent
Sequence:	tgcataaaaaAGCCAACCCGCAGGTTGGCttttctcgtt

TF binding sites (TFBSs)

[SoxS,+] Phrase

Type	Transcription factor	Function	Promoter	Binding Sites				Growth Conditions	Evidence	Confidence level (C: Confirmed, S: Strong, W: Weak)	Reference(s)
Type	Transcription factor	Function	Promoter	LeftPos	RightPos	Central Rel-Pos	Sequence	Growth Conditions	Evidence		Reference(s)
proximal	SoxS	activator	fldAp	711573	711592	-61.5	ttccactttcATGTAGCACAGTGTGCAGTCctgctcgttt	nd	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS]	C	[8], [10], [11], [12]

Transcription factor	Function	Promoter	Binding Sites	Evidence (Confirmed, Strong, Weak)	Reference(s)
SoxS	activator	fldAp	711573	711592	-61.5	ttccactttcATGTAGCACAGTGTGCAGTCctgctcgttt	[EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ]	[8], [10], [11], [12]

Evidence
[COMP-AINF] Inferred computationally without human oversight
[COMP-HINF] Inferred by a human based on computational evidence
[COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping
[RS-EPT-CBR] RNA-seq using two enrichment strategies for primary transcripts and consistent biological replicates
[COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.
[EXP-IMP-SITE-MUTATION] Site mutation
[EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins
[EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis
[EXP-DAP-SEQ] high throughput DNA Affinity Purification (DAP) Sequencing
[EXP-IEP-RNA-SEQ] high throughput RNA-seq evidence
[EXP-CHIP-EXO-MANUAL] ChIP-exo evidence used in manual assertion
[EXP-CHIP-EXO] high throughput ChIP-exo evidence
[EXP-IEP] Inferred from expression pattern

Reference(s)
[1] De Lorenzo V., Herrero M., Giovannini F., Neilands JB., 1988, Fur (ferric uptake regulation) protein and CAP (catabolite-activator protein) modulate transcription of fur gene in Escherichia coli., Eur J Biochem 173(3):537-46
[2] Perez-Martin J., Espinosa M., 1993, Protein-induced bending as a transcriptional switch., Science 260(5109):805-7
[3] Schaffer S., Hantke K., Braun V., 1985, Nucleotide sequence of the iron regulatory gene fur., Mol Gen Genet 200(1):110-3
[4] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78
[5] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Muñiz-Rascado L, García-Sotelo JS, Weiss V, Solano-Lira H, Martínez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hernández S, Alquicira-Hernández K, López-Fuentes A, Porrón-Sotelo L, Huerta AM, Bonavides-Martínez C, Balderas-Martínez YI, Pannier L, Olvera M, Labastida A, Jiménez-Jacinto V, Vega-Alvarado L, Del Moral-Chávez V, Hernández-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.
[6] Chen Z., Lewis KA., Shultzaberger RK., Lyakhov IG., Zheng M., Doan B., Storz G., Schneider TD., 2007, Discovery of Fur binding site clusters in Escherichia coli by information theory models., Nucleic Acids Res 35(20):6762-77
[7] Newman DL., Shapiro JA., 1999, Differential fiu-lacZ fusion regulation linked to Escherichia coli colony development., Mol Microbiol 33(1):18-32
[8] Zheng M., Doan B., Schneider TD., Storz G., 1999, OxyR and SoxRS regulation of fur., J Bacteriol 181(15):4639-43
[9] Vecerek B., Moll I., Blasi U., 2007, Control of Fur synthesis by the non-coding RNA RyhB and iron-responsive decoding., EMBO J 26(4):965-75
[10] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99
[11] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41
[12] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

RegulonDB