RegulonDB RegulonDB 10.8: Operon Form
   

gltI-sroC-gltJKL operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: gltI-sroC-gltJKL
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: gltIJKL-sroC
Synonym(s): gltIJKL
Gene(s): gltL, gltK, gltJ, sroC, gltI   Genome Browser M3D Gene expression COLOMBOS
Promoter
Name: gltIp1
+1: 687896
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 149
Sequence: aataggctgattcaaggcatttacgggagaaaaaatcggctcaaacatgaagaaatgaaaTgactgagtcagccgagaaga
                            -35                       -10   +1                   
Evidence: [HIPP]
[IC]
Reference(s): [1] Stafford GP., et al., 2005
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FlhDC activator gltIp1 687935 687953 -47.5 cggtctaaatAGGCTGATTCAAGGCATTTacgggagaaa nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1]
proximal FlhDC activator gltIp1 687950 687966 -62.0 aatggcgaagAAACGGTCTAAATAGGCtgattcaagg nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1]


Transcription unit       
Name: gltI-sroC-gltJKL
Gene(s): gltL, gltK, gltJ, sroC, gltI   Genome Browser M3D Gene expression COLOMBOS
Reference(s): [2] Zimmer DP., et al., 2000
Promoter
Name: gltIp
+1: Unknown
Sigma Factor: Sigma54 Sigmulon
Evidence: [AIPP]
Reference(s): [3] Reitzer L., et al., 2001


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  gcvB antisense translational regulation repressor 687791 687824 AGTTGCAGACGATAACAACACAAACACTCACAA
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -21.3 686681 686716 aacaatcttcGAGGGTAGCAGTTAACGCTGCTACCCTCTTTTTTCtggagtagat
  anti-terminator -6.8 686704 686744 cgggcctgaaAACCGCAATACGCTGGGTAACAATCTTCGAGGGTAGCAGTtaacgctgct
  anti-anti-terminator -25.61 686724 686799 cctctcgattGTTACGTAGCACGGACAGACTATACGCCTGATGGTCGTTCCCCATCGGGCCTGAAAACCGCAATACGCTGGGTAAcaatcttcga
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"





RegulonDB