RegulonDB RegulonDB 11.2: Operon Form
   

gadAXW operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: gadAXW
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: gadW
Gene(s): gadW   Genome Browser M3D Gene expression COLOMBOS
Note(s): Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009
The sequence of the putative stem-loop structure located 334 nt downstream of the gadW stop codon reportedly may function as a rho-independent terminator Tramonti A,2008 however, the putative terminator sequence was not shown in the paper.
The expression of the gene gadW is increased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Tramonti A., et al., 2008
Promoter
Name: gadWp1
+1: 3664651
Distance from start of the gene: 33
Sequence:
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Tramonti A., et al., 2008
Terminator(s)
Type: rho-independent
Sequence: gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct
Reference(s): [1] Tramonti A., et al., 2008
TF binding sites (TFBSs)
[YdeO,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal YdeO activator gadWp1 3664654 3664675 -13.0 agtctggcatCATTTCATTAGTATACTGAAATtgaaataatc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2]


Transcription unit          
Name: gadW
Gene(s): gadW   Genome Browser M3D Gene expression COLOMBOS
Note(s): Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009
The expression of the gadW gene was induced by SidA in the presence of N-(3-oxo-hexanoyl)-L-homoserine lactone (AHL) at 30 C, although the expression was negatively responsive in the presence of ethyl acetate (EA) at 37 C Dyszel JL,2010 It is not known if the regulation of the gadW gene by SdiA is dependent on the gadWp1 or gadWp2 promoter or both.
The transcription of gadW appears to be increased under acidic growth conditions during the exponential phase in a RcsB-dependent manner, but not during stationary phase Johnson MD,2011. Marzan LW,2013 However, it is not known which of the three promoters that transcribe this gene is affected by RcsB.
The sequence of the putative stem-loop structure located 334 nt downstream of the gadW stop codon reportedly may function as a rho-independent terminator Tramonti A,2008 however, the putative terminator sequence was not shown in the paper.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [1] Tramonti A., et al., 2008
Promoter
Name: gadWp2
+1: 3664781
Distance from start of the gene: 163
Sequence:
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [1] Tramonti A., et al., 2008
Terminator(s)
Type: rho-independent
Sequence: gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct
Reference(s): [1] Tramonti A., et al., 2008
TF binding sites (TFBSs)
[GadW,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadW repressor gadWp2 3664804 3664823 -32.5 atcagccattTTTTTATAAACATAAGCTATacgctgtgcg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1]
proximal GadW repressor gadWp2 3664825 3664844 -53.5 ataacttttaCTGGAAATAAGATCAGCCATttttttataa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1]
[GadX,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadX repressor gadWp2 3664804 3664823 -32.5 atcagccattTTTTTATAAACATAAGCTATacgctgtgcg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1]
proximal GadX repressor gadWp2 3664825 3664844 -53.5 ataacttttaCTGGAAATAAGATCAGCCATttttttataa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1]
proximal GadX repressor gadWp2 3664840 3664859 -68.5 ctcagtaagtTAAATATAACTTTTACTGGAaataagatca nd [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [3]
remote GadX repressor gadWp2 3664868 3664887 -96.5 tccctgttggCACGGGAAACTTTGTGCTCTcagtaagtta nd [EXP-IEP-RNA-SEQ], [COMP-HINF], [EXP-CHIP-EXO-MANUAL] S [3]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor gadWp2 nd nd nd nd nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [7]
[PhoP,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PhoP-phosphorylated activator gadWp2 3664801 3664817 -28.0 catttttttaTAAACATAAGCTATACGctgtgcgaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [4]
[SdiA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd SdiA activator gadWp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [5], [6]


Transcription unit          
Name: gadXW
Gene(s): gadW, gadX   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
[EXP-IEP-COREGULATION] Inferred through co-regulation
Reference(s): [1] Tramonti A., et al., 2008
[8] Tucker DL., et al., 2003
Promoter
Name: gadXp
+1: 3665839
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 29
Sequence: tttaaatttatttatcaatcaatttgacttaagagggcggcgtgctacattaataaacagTaatatgtttatgtaatatta
                             -35                   -10      +1                   
Evidence: [COMP-AINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[COMP-HINF-SIMILAR-TO-CONSENSUS]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [9] Huerta AM., et al., 2003
[10] Tramonti A., et al., 2002
Terminator(s)
Type: rho-independent
Sequence: gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct
Reference(s): [1] Tramonti A., et al., 2008
TF binding sites (TFBSs)
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote FNR repressor gadXp 3665992 3666005 -159.5 aagggattatTTGCTTACTATTAAtttccctgtg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [14]
[GadE,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadE activator gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]
[GadW,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadW repressor gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [16]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadX activator gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1], [15], [16]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [18], [19]
[PhoB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd PhoB-phosphorylated activator gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [17]
[RutR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote RutR repressor gadXp 3666654 3666674 -824.5 ggtgttcaacGTTGACTACCTGGGTGGTCAAattggtactt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [13]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA GadY gadXW activator 3664864 3664968 ACUGAGAGCACAAAGUUUCCCGUGCCAACAGGGAGUGUUAUAACGGUUUAUUAGUCUGGAGACGGCAGACUAUCCUCUUCCCGGUCCCCUAUGCCGGGUUUUUUU MRNA-DEGRADATION [EXP-IMP] [11], [12]


Transcription unit          
Name: gadX
Gene(s): gadX   Genome Browser M3D Gene expression COLOMBOS
Note(s): gadX gene expression is induced under exposure to hydrogen peroxide Hodges AP,2010
UspE regulates positively the transcription of the gadX gene in an unknown way, and GadX induces the transcription of uspE Hodges AP,2010
The expression of the gene gadX is increased by PhoB under acidic growth conditions Marzan LW,2013
The mRNA produced by the gadX gene has been observed mainly in the poles of the cell Kannaiah S, Livny J, Amster-Choder O,2019.
Evidence: [EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [10] Tramonti A., et al., 2002
Promoter
Name: gadXp
+1: 3665839
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 29
Sequence: tttaaatttatttatcaatcaatttgacttaagagggcggcgtgctacattaataaacagTaatatgtttatgtaatatta
                             -35                   -10      +1                   
Evidence: [COMP-AINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[COMP-HINF-SIMILAR-TO-CONSENSUS]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [9] Huerta AM., et al., 2003
[10] Tramonti A., et al., 2002
Terminator(s)
Type: rho-independent
Sequence: aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc
Reference(s): [10] Tramonti A., et al., 2002
TF binding sites (TFBSs)
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote FNR repressor gadXp 3665992 3666005 -159.5 aagggattatTTGCTTACTATTAAtttccctgtg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [14]
[GadE,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadE activator gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [15]
[GadW,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadW repressor gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [16]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd GadX activator gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1], [15], [16]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [18], [19]
[PhoB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd PhoB-phosphorylated activator gadXp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [17]
[RutR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote RutR repressor gadXp 3666654 3666674 -824.5 ggtgttcaacGTTGACTACCTGGGTGGTCAAattggtactt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [13]


Transcription unit          
Name: gadAX
Gene(s): gadX, gadA   Genome Browser M3D Gene expression COLOMBOS
Note(s): Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009
Basal GadE activity is required for activation of gadA and gadBC expression during stationary-phase growth Castanie-Cornet MP,2007
The transcription of gadAX appears to be increased under acidic growth conditions during stationary and exponential phases in a RcsB-dependent manner Johnson MD,2011. Marzan LW,2013
RcsB activity through both the RcsCD phosphorelay pathway and the RcsA pathway lowers the acid resistance Castanie-Cornet MP,2007 The role of this negative regulation might be to prevent costly runaway expression of the gad genes or to shut off the response, once the acid stress is over Castanie-Cornet MP,2007
Indole enhances the expression of several genes related to acid resistance, such as gadA, gadB, gadC, hdeA, hdeB, hdeD, slp, and gadE Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010 The acid resistance phenotype induced by indoles is mainly due to increased expression of the glutamine decarboxylase system Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010
The gadAp promoter is strongly induced by GreA overproduction only when DksA is absent, as are many other genes Vinella D, Potrykus K, Murphy H, Cashel M,2012. gadA is induced during biofilm formation Giangrossi M,2005. Schembri MA, Kjaergaard K, Klemm P,2003
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
[EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [13] Shimada T., et al., 2007
[10] Tramonti A., et al., 2002
[20] Waterman SR., et al., 2003
Promoter
Name: gadAp
+1: 3667607
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 27
Sequence: tatttaaattaagcctgtaatgccttgcttccattgcggataaatcctacttttttattgCcttcaaataaatttaaggag
                              -35                    -10    +1                   
Note(s): σ38 factor is required for stationary phase induction but not acid induction of the gadA promoter Castanie-Cornet MP,2001. Waterman SR,2003 were able to detect transcripts of gadA in an hns rpoS double mutant, suggesting that the gadAp promoter can also be recognized by σ70.
Evidence: [COMP-AINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
Reference(s): [21] Castanie-Cornet MP., et al., 2001
[9] Huerta AM., et al., 2003
[22] Itou J., et al., 2009
[23] Maciag A., et al., 2011
[20] Waterman SR., et al., 2003
Terminator(s)
Type: rho-independent
Sequence: aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc
Reference(s): [10] Tramonti A., et al., 2002
TF binding sites (TFBSs)
[AdiY,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd AdiY activator gadAp nd nd nd nd nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [7]
[ArcA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd ArcA-phosphorylated activator gadAp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [32]
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP repressor gadAp 3667659 3667680 -62.5 cgtttttctgCTTAGGATTTTGTTATTTAAATtaagcctgta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [21]
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR repressor gadAp 3667590 3667603 11.5 ttattgccttCAAATAAATTTAAGgagttcgaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [14]
[Fis,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis repressor gadAp 3667616 3667635 -18.0 ccttgcttccATTGCGGATAAATCCTACTTttttattgcc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
remote Fis repressor gadAp 3667692 3667711 -94.0 tatcatgttaAATGTTTATATTATAAAAAGtcgtttttct nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
remote Fis repressor gadAp 3667716 3667735 -118.0 gataataaagTCTGTTTTTAATATTATCATgttaaatgtt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
remote Fis repressor gadAp 3667745 3667764 -147.0 aacagcaatgTTTGGGCGATTTTTATTACGataataaagt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
[GadE-RcsB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadE-RcsB activator gadAp 3667660 3667680 -62.5 cgtttttctgCTTAGGATTTTGTTATTTAAAttaagcctgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [3], [15], [21], [22], [26], [27], [28], [29], [30]
[GadW,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadW activator gadAp 3667655 3667674 -57.5 tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
proximal GadW activator gadAp 3667676 3667695 -78.0 tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
remote GadW activator gadAp 3667698 3667717 -100.5 taatattatcATGTTAAATGTTTATATTATaaaaagtcgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
remote GadW activator gadAp 3667719 3667738 -121.5 tacgataataAAGTCTGTTTTTAATATTATcatgttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
[GadW,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadW repressor gadAp 3667655 3667674 -57.5 tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
proximal GadW repressor gadAp 3667676 3667695 -78.0 tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
remote GadW repressor gadAp 3667698 3667717 -100.5 taatattatcATGTTAAATGTTTATATTATaaaaagtcgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
remote GadW repressor gadAp 3667719 3667738 -121.5 tacgataataAAGTCTGTTTTTAATATTATcatgttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadX activator gadAp 3667608 3667627 -10.5 ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
proximal GadX activator gadAp 3667629 3667648 -31.5 taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
proximal GadX activator gadAp 3667655 3667674 -57.5 tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
proximal GadX activator gadAp 3667676 3667695 -78.0 tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
remote GadX activator gadAp 3667698 3667717 -100.5 taatattatcATGTTAAATGTTTATATTATaaaaagtcgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
remote GadX activator gadAp 3667719 3667738 -121.5 tacgataataAAGTCTGTTTTTAATATTATcatgttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor gadAp nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10], [16], [18]
[RcsB,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RcsB-phosphorylated repressor gadAp 3667619 3667632 -18.5 tgcttccattGCGGATAAATCCTActtttttatt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [27], [28], [31]
[TorR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote TorR-phosphorylated repressor gadAp 3667530 3667539 73.5 cagaactactCGATTCACGTtttggcgcaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [25]
remote TorR-phosphorylated repressor gadAp 3667725 3667734 -122.5 ataataaagtCTGTTTTTAAtattatcatg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [25]


Transcription unit          
Name: gadAX
Gene(s): gadX, gadA   Genome Browser M3D Gene expression COLOMBOS
Note(s): Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress Moen B,2009
Basal GadE activity is required for activation of gadA and gadBC expression during stationary-phase growth Castanie-Cornet MP,2007
The transcription of gadAX appears to be increased under acidic growth conditions during stationary and exponential phases in a RcsB-dependent manner Johnson MD,2011. Marzan LW,2013
RcsB activity through both the RcsCD phosphorelay pathway and the RcsA pathway lowers the acid resistance Castanie-Cornet MP,2007 The role of this negative regulation might be to prevent costly runaway expression of the gad genes or to shut off the response, once the acid stress is over Castanie-Cornet MP,2007
Indole enhances the expression of several genes related to acid resistance, such as gadA, gadB, gadC, hdeA, hdeB, hdeD, slp, and gadE Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010 The acid resistance phenotype induced by indoles is mainly due to increased expression of the glutamine decarboxylase system Hirakawa H, Hayashi-Nishino M, Yamaguchi A, Nishino K,2010
The gadAp promoter is strongly induced by GreA overproduction only when DksA is absent, as are many other genes Vinella D, Potrykus K, Murphy H, Cashel M,2012. gadA is induced during biofilm formation Giangrossi M,2005. Schembri MA, Kjaergaard K, Klemm P,2003
Evidence: [EXP-IDA-BOUNDARIES-DEFINED] Boundaries of transcription experimentally identified
[EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [13] Shimada T., et al., 2007
[10] Tramonti A., et al., 2002
[20] Waterman SR., et al., 2003
Promoter
Name: gadAp2
+1: 3667607
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 27
Sequence: tatttaaattaagcctgtaatgccttgcttccattgcggataaatcctacttttttattgCcttcaaataaatttaaggag
                              -35                       -10 +1                   
Note(s): σ38 factor is required for stationary phase induction but not acid induction of the gadA promoter Castanie-Cornet MP,2001. Waterman SR,2003 were able to detect transcripts of gadA in an hns rpoS double mutant, suggesting that the gadAp promoter can also be recognized by σ70.
Evidence: [COMP-HINF]
[COMP-HINF-POSITIONAL-IDENTIFICATION]
[EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
[EXP-IEP]
Reference(s): [21] Castanie-Cornet MP., et al., 2001
[33] Dudin O., et al., 2013
[22] Itou J., et al., 2009
[20] Waterman SR., et al., 2003
Terminator(s)
Type: rho-independent
Sequence: aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc
Reference(s): [10] Tramonti A., et al., 2002
TF binding sites (TFBSs)
[AdiY,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd AdiY activator gadAp2 nd nd nd nd nd [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] nd [7]
[ArcA,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd ArcA-phosphorylated activator gadAp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [32]
[CRP,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CRP-cyclic-AMP repressor gadAp2 3667659 3667680 -62.5 cgtttttctgCTTAGGATTTTGTTATTTAAATtaagcctgta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS] W [21]
[FNR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal FNR repressor gadAp2 3667590 3667603 11.5 ttattgccttCAAATAAATTTAAGgagttcgaaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [14]
[Fis,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fis repressor gadAp2 3667616 3667635 -18.0 ccttgcttccATTGCGGATAAATCCTACTTttttattgcc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
remote Fis repressor gadAp2 3667692 3667711 -94.0 tatcatgttaAATGTTTATATTATAAAAAGtcgtttttct nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
remote Fis repressor gadAp2 3667716 3667735 -118.0 gataataaagTCTGTTTTTAATATTATCATgttaaatgtt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
remote Fis repressor gadAp2 3667745 3667764 -147.0 aacagcaatgTTTGGGCGATTTTTATTACGataataaagt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [24]
[GadE-RcsB,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadE-RcsB activator gadAp2 3667660 3667680 -62.5 cgtttttctgCTTAGGATTTTGTTATTTAAAttaagcctgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IEP-RNA-SEQ], [COMP-HINF], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-CHIP-EXO-MANUAL], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [3], [15], [21], [22], [26], [27], [28], [29], [30]
[GadW,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadW activator gadAp2 3667655 3667674 -57.5 tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
proximal GadW activator gadAp2 3667676 3667695 -78.0 tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
remote GadW activator gadAp2 3667698 3667717 -100.5 taatattatcATGTTAAATGTTTATATTATaaaaagtcgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
remote GadW activator gadAp2 3667719 3667738 -121.5 tacgataataAAGTCTGTTTTTAATATTATcatgttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
[GadW,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadW repressor gadAp2 3667655 3667674 -57.5 tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
proximal GadW repressor gadAp2 3667676 3667695 -78.0 tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16]
remote GadW repressor gadAp2 3667698 3667717 -100.5 taatattatcATGTTAAATGTTTATATTATaaaaagtcgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
remote GadW repressor gadAp2 3667719 3667738 -121.5 tacgataataAAGTCTGTTTTTAATATTATcatgttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [16], [26]
[GadX,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal GadX activator gadAp2 3667608 3667627 -10.5 ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
proximal GadX activator gadAp2 3667629 3667648 -31.5 taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
proximal GadX activator gadAp2 3667655 3667674 -57.5 tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
proximal GadX activator gadAp2 3667676 3667695 -78.0 tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
remote GadX activator gadAp2 3667698 3667717 -100.5 taatattatcATGTTAAATGTTTATATTATaaaaagtcgt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
remote GadX activator gadAp2 3667719 3667738 -121.5 tacgataataAAGTCTGTTTTTAATATTATcatgttaaat nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [8], [10], [16], [18], [26]
[H-NS,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
nd H-NS repressor gadAp2 nd nd nd nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [10], [16], [18]
[RcsB,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RcsB-phosphorylated repressor gadAp2 3667619 3667632 -18.5 tgcttccattGCGGATAAATCCTActtttttatt nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-HINF], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS], [EXP-IMP-SITE-MUTATION] C [27], [28], [31]
[TorR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote TorR-phosphorylated repressor gadAp2 3667530 3667539 73.5 cagaactactCGATTCACGTtttggcgcaa nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [25]
remote TorR-phosphorylated repressor gadAp2 3667725 3667734 -122.5 ataataaagtCTGTTTTTAAtattatcatg nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS] W [25]
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp activation gadAp2 nd   [EXP-IEP-MICROARRAY] [34]
Evidence: [EXP-IEP-MICROARRAY] high throughput expression microarray evidence
Reference(s): [34] Traxler MF., et al., 2008


RNA cis-regulatory element    
Regulation, transcriptional elongation  
Attenuator type: Transcriptional
Strand: reverse
  Structure type Energy LeftPos RightPos Sequence (RNA-strand)
  terminator -21.6 3667748 3667783 taattaatttGATCGCCCGAACAGCAATGTTTGGGCGATTTTTATtacgataata
Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos"


Evidence    

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-HINF] Inferred by a human based on computational evidence

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IEP-RNA-SEQ] high throughput RNA-seq evidence

 [EXP-CHIP-EXO-MANUAL] ChIP-exo evidence used in manual assertion

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [COMP-AINF] Inferred computationally without human oversight

 [COMP-HINF-POSITIONAL-IDENTIFICATION] Human inference of promoter position

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [EXP-IMP] Inferred from mutant phenotype

 [EXP-IEP] Inferred from expression pattern

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol 70(4):965-82

 [2] Yamanaka Y., Oshima T., Ishihama A., Yamamoto K., 2014, Characterization of the YdeO regulon in Escherichia coli., PLoS One 9(11):e111962

 [3] Seo SW., Kim D., O'Brien EJ., Szubin R., Palsson BO., 2015, Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli., Nat Commun 6:7970

 [4] Zwir I., Shin D., Kato A., Nishino K., Latifi T., Solomon F., Hare JM., Huang H., Groisman EA., 2005, Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica., Proc Natl Acad Sci U S A 102(8):2862-7

 [5] Dyszel JL., Soares JA., Swearingen MC., Lindsay A., Smith JN., Ahmer BM., 2010, E. coli K-12 and EHEC genes regulated by SdiA., PLoS One 5(1):e8946

 [6] Ma X., Zhang S., Xu Z., Li H., Xiao Q., Qiu F., Zhang W., Long Y., Zheng D., Huang B., Chen C., Lu Y., 2020, SdiA Improves the Acid Tolerance of E. coli by Regulating GadW and GadY Expression., Front Microbiol 11:1078

 [7] Krin E., Danchin A., Soutourina O., 2010, Decrypting the H-NS-dependent regulatory cascade of acid stress resistance in Escherichia coli., BMC Microbiol 10:273

 [8] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol 185(10):3190-201

 [9] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [10] Tramonti A., Visca P., De Canio M., Falconi M., De Biase D., 2002, Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system., J Bacteriol 184(10):2603-13

 [11] Opdyke JA., Fozo EM., Hemm MR., Storz G., 2011, RNase III participates in GadY-dependent cleavage of the gadX-gadW mRNA., J Mol Biol 406(1):29-43

 [12] Opdyke JA., Kang JG., Storz G., 2004, GadY, a small-RNA regulator of acid response genes in Escherichia coli., J Bacteriol 186(20):6698-705

 [13] Shimada T., Hirao K., Kori A., Yamamoto K., Ishihama A., 2007, RutR is the uracil/thymine-sensing master regulator of a set of genes for synthesis and degradation of pyrimidines., Mol Microbiol 66(3):744-57

 [14] Constantinidou C., Hobman JL., Griffiths L., Patel MD., Penn CW., Cole JA., Overton TW., 2006, A reassessment of the FNR regulon and transcriptomic analysis of the effects of nitrate, nitrite, NarXL, and NarQP as Escherichia coli K12 adapts from aerobic to anaerobic growth., J Biol Chem 281(8):4802-15

 [15] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [16] Ma Z., Richard H., Tucker DL., Conway T., Foster JW., 2002, Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW)., J Bacteriol 184(24):7001-12

 [17] Marzan LW., Hasan CM., Shimizu K., 2013, Effect of acidic condition on the metabolic regulation of Escherichia coli and its phoB mutant., Arch Microbiol 195(3):161-71

 [18] Giangrossi M., Zattoni S., Tramonti A., De Biase D., Falconi M., 2005, Antagonistic role of H-NS and GadX in the regulation of the glutamate decarboxylase-dependent acid resistance system in Escherichia coli., J Biol Chem 280(22):21498-505

 [19] Hommais F., Krin E., Laurent-Winter C., Soutourina O., Malpertuy A., Le Caer JP., Danchin A., Bertin P., 2001, Large-scale monitoring of pleiotropic regulation of gene expression by the prokaryotic nucleoid-associated protein, H-NS., Mol Microbiol 40(1):20-36

 [20] Waterman SR., Small PL., 2003, Transcriptional expression of Escherichia coli glutamate-dependent acid resistance genes gadA and gadBC in an hns rpoS mutant., J Bacteriol 185(15):4644-7

 [21] Castanie-Cornet MP., Foster JW., 2001, Escherichia coli acid resistance: cAMP receptor protein and a 20 bp cis-acting sequence control pH and stationary phase expression of the gadA and gadBC glutamate decarboxylase genes., Microbiology 147(Pt 3):709-15

 [22] Itou J., Eguchi Y., Utsumi R., 2009, Molecular mechanism of transcriptional cascade initiated by the EvgS/EvgA system in Escherichia coli K-12., Biosci Biotechnol Biochem 73(4):870-8

 [23] Maciag A., Peano C., Pietrelli A., Egli T., De Bellis G., Landini P., 2011, In vitro transcription profiling of the σS subunit of bacterial RNA polymerase: re-definition of the σS regulon and identification of σS-specific promoter sequence elements., Nucleic Acids Res 39(13):5338-55

 [24] Bradley MD., Beach MB., de Koning AP., Pratt TS., Osuna R., 2007, Effects of Fis on Escherichia coli gene expression during different growth stages., Microbiology 153(Pt 9):2922-40

 [25] Bordi C., Theraulaz L., Mejean V., Jourlin-Castelli C., 2003, Anticipating an alkaline stress through the Tor phosphorelay system in Escherichia coli., Mol Microbiol 48(1):211-23

 [26] Tramonti A., De Canio M., Delany I., Scarlato V., De Biase D., 2006, Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli., J Bacteriol 188(23):8118-27

 [27] Castanie-Cornet MP., Cam K., Bastiat B., Cros A., Bordes P., Gutierrez C., 2010, Acid stress response in Escherichia coli: mechanism of regulation of gadA transcription by RcsB and GadE., Nucleic Acids Res 38(11):3546-54

 [28] Castanie-Cornet MP., Treffandier H., Francez-Charlot A., Gutierrez C., Cam K., 2007, The glutamate-dependent acid resistance system in Escherichia coli: essential and dual role of the His-Asp phosphorelay RcsCDB/AF., Microbiology 153(Pt 1):238-46

 [29] Johnson MD., Burton NA., Gutierrez B., Painter K., Lund PA., 2011, RcsB Is Required for Inducible Acid Resistance in Escherichia coli and Acts at gadE-Dependent and -Independent Promoters., J Bacteriol 193(14):3653-6

 [30] Ma Z., Gong S., Richard H., Tucker DL., Conway T., Foster JW., 2003, GadE (YhiE) activates glutamate decarboxylase-dependent acid resistance in Escherichia coli K-12., Mol Microbiol 49(5):1309-20

 [31] Krin E., Danchin A., Soutourina O., 2010, RcsB plays a central role in H-NS-dependent regulation of motility and acid stress resistance in Escherichia coli., Res Microbiol 161(5):363-371

 [32] Salmon KA., Hung SP., Steffen NR., Krupp R., Baldi P., Hatfield GW., Gunsalus RP., 2005, Global gene expression profiling in Escherichia coli K12: effects of oxygen availability and ArcA., J Biol Chem 280(15):15084-96

 [33] Dudin O., Lacour S., Geiselmann J., 2013, Expression dynamics of RpoS/Crl-dependent genes in Escherichia coli., Res Microbiol 164(8):838-47

 [34] Traxler MF., Summers SM., Nguyen HT., Zacharia VM., Hightower GA., Smith JT., Conway T., 2008, The global, ppGpp-mediated stringent response to amino acid starvation in Escherichia coli., Mol Microbiol 68(5):1128-48

RegulonDB