|
|
| Operon |  |
|---|---|
| Name: | gadAXW |
| This page displays every known transcription unit of this operon and their known regulation. | |
| Name: | gadW | ||||||||||||
| Gene(s): | gadW Genome Browser M3D Gene expression COLOMBOS | ||||||||||||
| Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress |CITS:[19767843]|. The sequence of the putative stem-loop structure located 334 nt downstream of the gadW stop codon reportedly may function as a rho-independent terminator |CITS:[18808381]|; however, the putative terminator sequence was not shown in the paper. The expression of the gene gadW is increased under acidic growth conditions in either aerobiosis or microaerobiosis |CITS:[23274360]|. |
||||||||||||
| Evidence: | [LTED] Length of transcript experimentally determined | ||||||||||||
| Reference(s): | [1] Tramonti A., et al., 2008 | ||||||||||||
| Promoter | |||||||||||||
| Name: | gadWp1 | ||||||||||||
| +1: | 3664651 | ||||||||||||
| Distance from start of the gene: | 33 | ||||||||||||
| Sequence: |
| Evidence: |
[TIM]
|
Reference(s): |
[1] Tramonti A., et al., 2008
|
Terminator(s) |
| Type: |
rho-independent |
Sequence: |
gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct |
Reference(s): |
[1] Tramonti A., et al., 2008
|
|
| Name: | gadW | ||||||||||||
| Gene(s): | gadW Genome Browser M3D Gene expression COLOMBOS | ||||||||||||
| Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress |CITS:[19767843]|. The expression of the gadW gene was induced by SidA in the presence of N-(3-oxo-hexanoyl)-L-homoserine lactone (AHL) at 30 C, although the expression was negatively responsive in the presence of ethyl acetate (EA) at 37 C |CITS:[20126629]|. It is not known if the regulation of the gadW gene by SdiA is dependent on the gadWp1 or gadWp2 promoter or both. The transcription of gadW appears to be increased under acidic growth conditions during the exponential phase in a RcsB-dependent manner, but not during stationary phase |CITS:[21571995][23274360]|. However, it is not known which of the three promoters that transcribe this gene is affected by RcsB. The sequence of the putative stem-loop structure located 334 nt downstream of the gadW stop codon reportedly may function as a rho-independent terminator |CITS:[18808381]|; however, the putative terminator sequence was not shown in the paper. |
||||||||||||
| Evidence: | [LTED] Length of transcript experimentally determined | ||||||||||||
| Reference(s): | [1] Tramonti A., et al., 2008 | ||||||||||||
| Promoter | |||||||||||||
| Name: | gadWp2 | ||||||||||||
| +1: | 3664781 | ||||||||||||
| Distance from start of the gene: | 163 | ||||||||||||
| Sequence: |
| Evidence: |
[IMP] |
[MSI] [TIM] Reference(s): |
[3] Cavaliere P., et al., 2016 |
[1] Tramonti A., et al., 2008 [4] Typas A., et al., 2007 Terminator(s) |
| Type: |
rho-independent |
Sequence: |
gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct |
Reference(s): |
[1] Tramonti A., et al., 2008
|
|
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | GadW | repressor | gadWp2 | 3664804 | 3664823 | -32.5 | atcagccattTTTTTATAAACATAAGCTATacgctgtgcg | nd | [GEA] | [1] |
| proximal | GadW | repressor | gadWp2 | 3664825 | 3664844 | -53.5 | ataacttttaCTGGAAATAAGATCAGCCATttttttataa | nd | [GEA] | [1] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | GadX | repressor | gadWp2 | 3664804 | 3664823 | -32.5 | atcagccattTTTTTATAAACATAAGCTATacgctgtgcg | nd | [GEA] | [1] |
| proximal | GadX | repressor | gadWp2 | 3664825 | 3664844 | -53.5 | ataacttttaCTGGAAATAAGATCAGCCATttttttataa | nd | [GEA] | [1] |
| proximal | GadX | repressor | gadWp2 | 3664840 | 3664859 | -68.5 | ctcagtaagtTAAATATAACTTTTACTGGAaataagatca | nd | , [IHBCE], | [5] |
| remote | GadX | repressor | gadWp2 | 3664868 | 3664887 | -96.5 | tccctgttggCACGGGAAACTTTGTGCTCTcagtaagtta | nd | , [IHBCE], | [5] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | PhoP-Phosphorylated | activator | gadWp2 | 3664801 | 3664817 | -28.0 | catttttttaTAAACATAAGCTATACGctgtgcgaaa | nd | [APIORCISFBSCS], [BPP], [GEA] | [6] |
| Name: | gadX |
| Gene(s): | gadX Genome Browser M3D Gene expression COLOMBOS |
| Note(s): | gadX gene expression is induced under exposure to hydrogen peroxide |CITS:[20209085]|. UspE regulates positively the transcription of the gadX gene in an unknown way, and GadX induces the transcription of uspE |CITS:[ 20209085]|. The expression of the gene gadX is increased by PhoB under acidic growth conditions |CITS:[ 23274360]|. |
| Evidence: | [LTED] Length of transcript experimentally determined |
| Reference(s): | [9] Tramonti A., et al., 2002 |
| Promoter | |
| Name: | gadXp |
| +1: | 3665839 |
| Sigma Factor: | Sigma38 Sigmulon |
| Distance from start of the gene: | 29 |
| Sequence: |
tttaaatttatttatcaatcaatttgacttaagagggcggcgtgctacattaataaacagTaatatgtttatgtaatatta -35 -10 +1 |
| Evidence: |
[HIPP] [TIM] ; Method: Primer Extension [TIM] |
| Reference(s): | [9] Tramonti A., et al., 2002 |
| Terminator(s) | |
| Type: | rho-independent |
| Sequence: | aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc |
| Reference(s): | [9] Tramonti A., et al., 2002 |
| Note(s): |
1Two large footprinting regions for Hns binding, which are necessary for full repression, were identified around the regulatory region of the gadXp promoter (from +1 to -67 and from -86 to -153 ) . These regions may contain sites for several Hns molecules, but these specific sites have not been identified Giangrossi M,2005 The RNA polymerase binding to the gadXp promoter can be prevented by Hns protein that binds around the promoter region Giangrossi M,20056Two large footprinting regions for Hns binding, which are necessary for full repression, were identified around the regulatory region of the gadXp promoter (from +1 to -67 and from -86 to -153 ) . These regions may contain sites for several Hns molecules, but these specific sites have not been identified Giangrossi M,2005 The RNA polymerase binding to the gadXp promoter can be prevented by Hns protein that binds around the promoter region Giangrossi M,2005 |
| Name: | gadXW |
| Gene(s): | gadW, gadX Genome Browser M3D Gene expression COLOMBOS |
| Evidence: | [ITC] Inferred through co-regulation [LTED] Length of transcript experimentally determined |
| Reference(s): |
[1] Tramonti A., et al., 2008 [17] Tucker DL., et al., 2003 |
| Promoter | |
| Name: | gadXp |
| +1: | 3665839 |
| Sigma Factor: | Sigma38 Sigmulon |
| Distance from start of the gene: | 29 |
| Sequence: |
tttaaatttatttatcaatcaatttgacttaagagggcggcgtgctacattaataaacagTaatatgtttatgtaatatta -35 -10 +1 |
| Evidence: |
[HIPP] [TIM] ; Method: Primer Extension [TIM] |
| Reference(s): | [9] Tramonti A., et al., 2002 |
| Terminator(s) | |
| Type: | rho-independent |
| Sequence: | gtaaatgagaGTAAGGTTGAACATGAAGGTTCAGCCTTACTctttcctgct |
| Reference(s): | [1] Tramonti A., et al., 2008 |
| Note(s): |
1Two large footprinting regions for Hns binding, which are necessary for full repression, were identified around the regulatory region of the gadXp promoter (from +1 to -67 and from -86 to -153 ) . These regions may contain sites for several Hns molecules, but these specific sites have not been identified Giangrossi M,2005 The RNA polymerase binding to the gadXp promoter can be prevented by Hns protein that binds around the promoter region Giangrossi M,20056Two large footprinting regions for Hns binding, which are necessary for full repression, were identified around the regulatory region of the gadXp promoter (from +1 to -67 and from -86 to -153 ) . These regions may contain sites for several Hns molecules, but these specific sites have not been identified Giangrossi M,2005 The RNA polymerase binding to the gadXp promoter can be prevented by Hns protein that binds around the promoter region Giangrossi M,2005 |
| Name: | gadAX |
| Gene(s): | gadX, gadA Genome Browser M3D Gene expression COLOMBOS |
| Note(s): | Genes involved in the gad (gadABCDEWX) system are common under many adverse conditions, as determined by microarray analyses and Fourier transform-infrared spectroscopy. Although they are known to be important for the acid stress response, it has also been shown that part of this system is also upregulated by NaCl, cold stress, ethanol, and heat stress |CITS:[19767843]|. Basal GadE activity is required for activation of gadA and gadBC expression during stationary-phase growth |CITS:[17185552]|. The transcription of gadAX appears to be increased under acidic growth conditions during stationary and exponential phases in a RcsB-dependent manner |CITS:[21571995][23274360]|. RcsB activity through both the RcsCD phosphorelay pathway and the RcsA pathway lowers the acid resistance |CITS:[17185552]|. The role of this negative regulation might be to prevent costly runaway expression of the gad genes or to shut off the response, once the acid stress is over |CITS:[17185552]|. Indole enhances the expression of several genes related to acid resistance, such as gadA, gadB, gadC, hdeA, hdeB, hdeD, slp, and gadE |CITS:[20470880]|. The acid resistance phenotype induced by indoles is mainly due to increased expression of the glutamine decarboxylase system |CITS:[20470880]|. The gadAp promoter is strongly induced by GreA overproduction only when DksA is absent, as are many other genes |CITS: [22056927]|. gadA is induced during biofilm formation |CITS:[15795232][12657059]|. |
| Evidence: | [BTEI] Boundaries of transcription experimentally identified [LTED] Length of transcript experimentally determined |
| Reference(s): |
[10] Shimada T., et al., 2007 [9] Tramonti A., et al., 2002 [18] Waterman SR., et al., 2003 |
| Promoter | |
| Name: | gadAp |
| +1: | 3667607 |
| Sigma Factor: | Sigma38, Sigma70, Sigma38, Sigma70 |
| Distance from start of the gene: | 27 |
| Sequence: |
tatttaaattaagcctgtaatgccttgcttccattgcggataaatcctacttttttattgCcttcaaataaatttaaggag -35 -10 +1 |
| Note(s): | σ38 factor is required for stationary phase induction but not acid induction of the gadA promoter Castanie-Cornet MP,2001. Waterman SR,2003 were able to detect transcripts of gadA in an hns rpoS double mutant, suggesting that the gadAp promoter can also be recognized by σ70. |
| Evidence: |
[HIPP] [TIM] |
| Reference(s): |
[19] Castanie-Cornet MP., et al., 2001 [20] Itou J., et al., 2009 [18] Waterman SR., et al., 2003 |
| Terminator(s) | |
| Type: | rho-independent |
| Sequence: | aacggtttatTAGTCTGGAGACGGCAGACTAtcctcttccc |
| Reference(s): | [9] Tramonti A., et al., 2002 |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | CRP-cAMP1 | repressor | gadAp | 3667659 | 3667680 | -62.5 | cgtttttctgCTTAGGATTTTGTTATTTAAATtaagcctgta | nd | [APIORCISFBSCS], [GEA] | [19] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | Fis | repressor | gadAp | 3667616 | 3667635 | -18.0 | ccttgcttccATTGCGGATAAATCCTACTTttttattgcc | nd | [AIBSCS], [GEA] | [21] |
| remote | Fis | repressor | gadAp | 3667692 | 3667711 | -94.0 | tatcatgttaAATGTTTATATTATAAAAAGtcgtttttct | nd | [AIBSCS], [GEA] | [21] |
| remote | Fis | repressor | gadAp | 3667716 | 3667735 | -118.0 | gataataaagTCTGTTTTTAATATTATCATgttaaatgtt | nd | [AIBSCS], [GEA] | [21] |
| remote | Fis | repressor | gadAp | 3667745 | 3667764 | -147.0 | aacagcaatgTTTGGGCGATTTTTATTACGataataaagt | nd | [AIBSCS], [GEA] | [21] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | GadE-RcsB1 | activator | gadAp | 3667660 | 3667680 | -62.5 | cgtttttctgCTTAGGATTTTGTTATTTAAAttaagcctgt | nd | [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], , [SM] | [5], [12], [19], [20], [23], [24], [25], [26], [27] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | GadW | activator | gadAp | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [BPP], [GEA] | [13], [17] |
| proximal | GadW | repressor | gadAp | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [BPP], [GEA] | [13], [17] |
| proximal | GadW | repressor | gadAp | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [BPP], [GEA] | [13], [17] |
| proximal | GadW | activator | gadAp | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [BPP], [GEA] | [13], [17] |
| remote | GadW | repressor | gadAp | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [13], [17], [23] |
| remote | GadW | activator | gadAp | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [13], [17], [23] |
| remote | GadW7 | repressor | gadAp | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [13], [17], [23] |
| remote | GadW8 | activator | gadAp | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [13], [17], [23] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | GadX | activator | gadAp | 3667608 | 3667627 | -10.5 | ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata | nd | [BPP], [GEA] | [9], [13], [15], [17], [23] |
| proximal | GadX | activator | gadAp | 3667629 | 3667648 | -31.5 | taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta | nd | [BPP], [GEA] | [9], [13], [15], [17], [23] |
| proximal | GadX | activator | gadAp | 3667655 | 3667674 | -57.5 | tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc | nd | [BPP], [GEA] | [9], [13], [15], [17], [23] |
| proximal | GadX | activator | gadAp | 3667676 | 3667695 | -78.0 | tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta | nd | [BPP], [GEA] | [9], [13], [15], [17], [23] |
| remote | GadX | activator | gadAp | 3667698 | 3667717 | -100.5 | taatattatcATGTTAAATGTTTATATTATaaaaagtcgt | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [9], [13], [15], [17], [23] |
| remote | GadX | activator | gadAp | 3667719 | 3667738 | -121.5 | tacgataataAAGTCTGTTTTTAATATTATcatgttaaat | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [9], [13], [15], [17], [23] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | RcsB-Pasp56 | repressor | gadAp | 3667619 | 3667632 | -18.5 | tgcttccattGCGGATAAATCCTActtttttatt | nd | [BPP], [GEA], [IHBCE], [SM] | [24], [25], [28] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| remote | TorR-Pasp | repressor | gadAp | 3667530 | 3667539 | 73.5 | cagaactactCGATTCACGTtttggcgcaa | nd | [AIBSCS], [GEA] | [22] |
| remote | TorR-Pasp | repressor | gadAp | 3667725 | 3667734 | -122.5 | ataataaagtCTGTTTTTAAtattatcatg | nd | [AIBSCS], [GEA] | [22] |
| Note(s): |
1ArcA appears to activate gadAX operon expression under anaerobiosis. A putative ArcA-binding site was identified 567 bp upstream of this operon Salmon KA,2005, but the sequence was not shown.1This potential site could belong to the CRP regulator, since it possesses 9 of the 16 consensus nucleotides associated with CRP binding Castanie-Cornet MP,2001. GadE and CRP bind to this site, controlling gadA expression during growth both under acidic conditions and in stationary phase.1GadE is required both for gadA/gadBC expression during exponential growth and stationary-phase expression. GadE is an acid-induced regulator since it is involved in the acid induction of gadA/gadBC operons during exponential growth. The expression of these operons may be one of the most intensively regulated systems in Escherichia coli, since it is regulated by different factors. GadE and GadX may simultaneously bind to the GAD box region of gadA/gadBC and form a complex Ma Z,2003.7GadW regulates positively the expression of gadA in the absence of GadX only to pH 8 Ma Z,2002. 8GadW regulates positively the expression of gadA in the absence of GadX only to pH 8 Ma Z,2002.1Two large footprinting regions for Hns binding, which are necessary for full repression, were identified around the regulatory region of the gadAp promoter (from +43 to -55 and from -86 to -133). These regions may contain sites for several Hns molecules, but these specific sites have not been identified Giangrossi M,2005 The RNA polymerase binding to the gadAp promoter can be prevented by the Hns protein which binds around the promoter region. Also, on the same region GadX can bind, competing with Hns for the same site; even GadX can remove the already-bound Hns Giangrossi M,2005.4GadW regulates positively the expression of gadA in the absence of GadX only to pH 8 Ma Z,2002. 5GadW regulates positively the expression of gadA in the absence of GadX only to pH 8 Ma Z,2002. 14GadE is required both for gadA/gadBC expression during exponential growth and stationary-phase expression. GadE is an acid-induced regulator since it is involved in the acid induction of gadA/gadBC operons during exponential growth. The expression of these operons may be one of the most intensively regulated systems in Escherichia coli, since it is regulated by different factors. GadE and GadX may simultaneously bind to the GAD box region of gadA/gadBC and form a complex Ma Z,2003. 15This potential site could belong to the CRP regulator, since it possesses 9 of the 16 consensus nucleotides associated with CRP binding Castanie-Cornet MP,2001. GadE and CRP bind to this site, controlling gadA expression during growth both under acidic conditions and in stationary phase. 25ArcA appears to activate gadAX operon expression under anaerobiosis. A putative ArcA-binding site was identified 567 bp upstream of this operon Salmon KA,2005, but the sequence was not shown. 27Two large footprinting regions for Hns binding, which are necessary for full repression, were identified around the regulatory region of the gadAp promoter (from +43 to -55 and from -86 to -133). These regions may contain sites for several Hns molecules, but these specific sites have not been identified Giangrossi M,2005 The RNA polymerase binding to the gadAp promoter can be prevented by the Hns protein which binds around the promoter region. Also, on the same region GadX can bind, competing with Hns for the same site; even GadX can remove the already-bound Hns Giangrossi M,2005. |
| Evidence: | [EME] Expression microarray evidence |
| Reference(s): | [30] Traxler MF., et al., 2008 |
| Regulation by sRNA | |
|---|
| Small RNA name (Regulator) | Regulation type | Mechanism | Function | Binding Sites | Evidence | Reference | |||
|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Sequence (RNA-strand) | |||||||
| gadY | base-pairing | post-transcriptional regulation | activator | 3665727 | 3665792 | AATTGTCTAATTGCGTATGCAAGACATAAATATATTCTCACCATGGTTAATGGTGAATATCGCTA | [GEA] [HIFS] [IMP] [IPI] |
[31] | |
| Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'" |
| RNA cis-regulatory element | |
|---|
| Regulation, transcriptional elongation | |
| Attenuator type: | Transcriptional |
| Strand: | reverse |
| Evidence: | [ICA] Inferred by computational analysis |
| Reference(s): | [32] Merino E, et al., 2005 |
| Structure type | Energy | LeftPos | RightPos | Sequence (RNA-strand) | |
|---|---|---|---|---|---|
| terminator | -21.6 | 3667748 | 3667783 | taattaatttGATCGCCCGAACAGCAATGTTTGGGCGATTTTTATtacgataata |
| Notes: "The provided "Sequence" is that of the RNA strand, i.e. U's are shown instead of T's and regulators on the reverse strand will appear as the reverse complement of the sequence delimited by LeftPos-RigtPos" |
| Reference(s) |
|
|---|---|
[TIM] Transcription initiation mapping