RegulonDB RegulonDB 10.8: Operon Form
   

tisB operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: tisB
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: tisB
Synonym(s): tisAB, ysdAB
Gene(s): tisB   Genome Browser M3D Gene expression COLOMBOS
Note(s): The tisAB operon, which codes for toxic peptides induced by SOS, seems to be transcriptionally regulated by LexA Fernandez De Henestrosa AR,2000. On the other hand, it is regulated during translation by the IstR-1 antisense RNA and the subsequent RNase III-dependent cleavage of both RNAs, induced by the SOS cell answer Vogel J,2004.
Evidence: [LTED] Length of transcript experimentally determined
Reference(s): [1] Fernandez De Henestrosa AR., et al., 2000
[2] Vogel J., et al., 2004
Promoter
Name: tisBp
+1: 3853337
Distance from start of the gene: 216
Sequence:
Evidence: [HIPP]
[TIM]
Reference(s): [2] Vogel J., et al., 2004
Terminator(s)
Type: rho-independent
Sequence: aagtcgcaccAAAGGGGAGCGGGAAACCGCTCCCCTTTtatatttagc
Reference(s): [2] Vogel J., et al., 2004
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal LexA repressor tisBp 3853299 3853318 -28.0 gtccaaatatTACTGTTTATTTATACAGTAaacttctata nd [CV(GEA)], [GEA], [ICA] [1], [2]


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  istR antisense post-transcriptional regulation repressor 3853528 3853571 GCTCCTGAACCACAGGAGACGCGTATGAACCTGGTGGATATCG
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"





RegulonDB