RegulonDB RegulonDB 10.6.3: Operon Form
   

mraZ-rsmH-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: mraZ-rsmH-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: mraZW-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC
Gene(s): mraZ, rsmH, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, lpxC   Genome Browser M3D Gene expression COLOMBOS
Note(s): The dcw cluster is formed by 16 genes (mraZW-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC) involved in cell division. It is probable that the dcw cluster conforms to an operon since there is no transcriptional termination signal within the whole gene region, allowing the complete transcription from mraZ to the furthest downstream gene (lpxC) |CITS:[9614967]|. A couple of antisense RNAs were identified in the dcw cluster by means of S1 mapping; however, its genomic position is not mentioned. This cluster is regulated by a variety of sophisticated mechanisms that together contribute to the precise timing of cell division |CITS:[9614967]|.
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
[PM] Polar mutation
Reference(s): [1] Hara H., et al., 1997
[2] Mengin-Lecreulx D., et al., 1998
[3] Vicente M., et al., 1998
Promoter
Name: mraZp
+1: 89596
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 38
Sequence: tatgccttgtgactggcttgacaagcttttcctcagctccgtaaactcctttcagtgggaAattgtggggcaaagtgggaa
                            -35                      -10    +1                   
Note(s): The contribution of the mraZp promoter to the expression level of the downstream genes has not been tested Vicente M,1998 This promoter is reported to have been identified by S1 mapping; however, the promoter was not shown, nor was its sequence given. There is a position mentioned in the paper in relation to the translational start site of the gene. The σ factor type that controls mraZp expression was not mentioned.
Evidence: [HIPP]
[TIM]
Reference(s): [1] Hara H., et al., 1997
[3] Vicente M., et al., 1998
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal MraZ repressor mraZp 89591 89595 -3.0 ctcctttcagTGGGAaattgtgggg nd [AIBSCS], [BPP], [GEA], [SM] [5]
proximal MraZ repressor mraZp 89601 89605 8.0 tgggaaattgTGGGGcaaagtggga nd [AIBSCS], [BPP], [GEA], [SM] [5]
proximal MraZ repressor mraZp 89611 89615 18.0 tggggcaaagTGGGAataaggggtg nd [AIBSCS], [BPP], [GEA], [SM] [5]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal PdhR repressor mraZp 89546 89562 -42.0 tatgccttgtGACTGGCTTGACAAGCTtttcctcagc nd [AIBSCS], [BPP], [GEA] [4]


Transcription unit       
Name: mraW-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC
Gene(s): rsmH, ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, lpxC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [3] Vicente M., et al., 1998
Promoter
Name: mraWp1
+1: 90010
Distance from start of the gene: 84
Sequence: aagaagtgatgctggttggacagttcaacaagtttgagctgtgggatgaaacaacctggcAtcaacaggtcaaggaagata
Note(s): The contribution of the mraWp1 promoter to the expression level of the downstream genes has not been tested Vicente M,1998 This promoter was reportedly identified by S1 mapping; however, the promoter was not shown nor was its sequence given. There is a position mentioned in the paper in relation to the translational start site of the gene. The σ factor type that controls mraWp1 expression was not mentioned.
Evidence: [TIM]
Reference(s): [3] Vicente M., et al., 1998


Transcription unit       
Name: ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC
Gene(s): ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, lpxC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [3] Vicente M., et al., 1998
Promoter
Name: ftsLp1
+1: 90688
Distance from start of the gene: 344
Sequence: cgcaccaaagaactggcggaagtcgtggctgctgcaacgccggtgaaagataagtttaaaCatcccgcgacccgtaccttc
Note(s): The contribution of the ftsLp1 promoter to the expression level of the downstream genes has not been tested Vicente M,1998 This promoter is reported to have been identified by S1 mapping; however, the promoter was not shown, nor was its sequence given. There is a position mentioned in the paper in relation with the translational start site of the gene. The σ factor type that controls ftsLp1 expression was not mentioned.
Evidence: [TIM]
Reference(s): [3] Vicente M., et al., 1998


Transcription unit          
Name: ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC
Gene(s): ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, lpxC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PAGTSBP] Products of adjacent genes in the same biological process
Reference(s): [3] Vicente M., et al., 1998
Promoter
Name: ftsLp2
+1: 91012
Distance from start of the gene: 20
Sequence: ttaatgccgggcgaagaagaggtggctgagaaccctcgtgcccgtagttcagttctgcgtAttgcagagaggacgaatgca
Note(s): The contribution of the ftsLp2 promoter to the expression level of the downstream genes has not been tested Vicente M,1998 This promoter is reported to have been identified by S1 mapping; however, the promoter was not shown nor was its sequence given. There is a position mentioned in the paper in relation to the translational start site of the gene. The σ factor type that controls ftsLp2 expression was not mentioned.
Evidence: [TIM]
Reference(s): [3] Vicente M., et al., 1998
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal LexA repressor ftsLp2 91004 91023 3.0 cgtagttcagTTCTGCGTATTGCAGAGAGGacgaatgcat nd [HIBSCS] [3], [6]


Transcription unit          
Name: ftsQ
Gene(s): ftsQ   Genome Browser M3D Gene expression COLOMBOS
Evidence: [IEP] Inferred from expression pattern
Reference(s): [7] Yamamoto K., et al., 2001
Promoter
Name: ftsQp2
+1: 102742
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 413
Sequence: cagtgtgggaatgtcaaaagtagtagcagaaaatgctctacaagatgcattaagattggcAtttcagcacgatgaagaagt
                           -35                -10           +1                   
Evidence: [HIPP]
[TIM]
Reference(s): [8] Aldea M., et al., 1990
[9] Ballesteros M., et al., 1998
[7] Yamamoto K., et al., 2001
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal SdiA1 activator ftsQp2 102697 102714 -36.5 tgggaatgtcAAAAGTAGTAGCAGAAAAtgctctacaa nd [BPP], [GEA] [7]
Note(s): 1The binding site of SdiA in the ftsQp2 promoter seems insensitive to its autoinducer Kim T, Duong T, Wu CA, Choi J, Lan N, Kang SW, Lokanath NK, Shin D, Hwang HY, Kim KK,20141The binding site of SdiA in the ftsQp2 promoter seems insensitive to its autoinducer Kim T, Duong T, Wu CA, Choi J, Lan N, Kang SW, Lokanath NK, Shin D, Hwang HY, Kim KK,2014


Transcription unit          
Name: ftsQAZ
Synonym(s): OP00295
Gene(s): ftsQ, ftsA, ftsZ   Genome Browser M3D Gene expression COLOMBOS
Note(s): This operon has two promoters located upstream of the ftsQ gene and three promoters upstream of the ftsZ gene. There is a putative specific promoter for the ftsA gene, but its precise location is still unknown.
Dyszel et al. showed that the transcription of the ftsQAZ and acrAB operons were only increased by the overexpression of SdiA from a plasmid, while expression of these operons was not increased by chromosomal sdiA and the presence of N-(3-oxo-hexanoyl)-L-homoserine lactone (AHL) at either 30 C or 37 C |CITS:[20126629]|.
Evidence: [ITCR] Inferred through co-regulation
Reference(s): [10] Wang XD., et al., 1991
Promoter
Name: ftsQp1
+1: 102867
Sigma Factor: Sigma38, Sigma70
Distance from start of the gene: 288
Sequence: tactcggtgaagaaattttaccgtcaatacgtattcaaccgtccggaaccttctatgattAtgaggcgaagtatctctctg
                                -35              -10        +1                   
Note(s): The ftsQp1 promoter belongs to the class of gearbox promoters and it is strongly induced in stationary phase.
Evidence: [HIPP]
[TIM]
Reference(s): [8] Aldea M., et al., 1990
[9] Ballesteros M., et al., 1998
[11] Sitnikov DM., et al., 1996
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote SdiA repressor ftsQp1 102695 102712 -163.5 tgtgggaatgTCAAAAGTAGTAGCAGAAaatgctctac nd [BPP], [GEA] [7], [10]
remote SdiA repressor ftsQp1 102697 102714 -161.5 tgggaatgtcAAAAGTAGTAGCAGAAAAtgctctacaa nd [BPP], [GEA] [7]
proximal SdiA repressor ftsQp1 102843 102860 -15.5 atacgtattcAACCGTCCGGAACCTTCTatgattatga nd [BPP] [7]
External database links:
UNIPROT:
P07026
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp activation ftsQp1 ftsQp1, ftsZp4, and ftsZp3 are attractive candidates for ppGpp activation, since they exhibit inverse growth rate regulation. Even so, the effect of ppGpp on the ftsZ gene could be indirect |CITS:[8407846]|. [IMP] [12]
[13]
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [12] Vinella D., et al., 1993
[13] Vinella D., et al., 1993


Transcription unit          
Name: ftsAZ
Gene(s): ftsA, ftsZ   Genome Browser M3D Gene expression COLOMBOS
Reference(s): [14] Carballes F., et al., 1999
Promoter
Name: ftsAp1
+1: 103561
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 421
Sequence: ctgatgaattgaagattcatctggttgaatatgtgccgattgcgcggtggaatgatcaacAtatggtagacgcggaaggaa
                         -35                    -10         +1                   
Note(s): ftsAp1 contributes about 1% of the ftsZ transcription.
Evidence: [HIPP]
[TIM]
Reference(s): [14] Carballes F., et al., 1999
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal RcsB-Pasp56 activator ftsAp1 103511 103524 -43.5 ctgatgaattGAAGATTCATCTGGttgaatatgt nd [GEA], [HIBSCS], [SM] [14]


Transcription unit       
Name: ftsZ
Gene(s): ftsZ   Genome Browser M3D Gene expression COLOMBOS
Evidence: [IEP] Inferred from expression pattern
Reference(s): [15] Flardh K., et al., 1997
Promoter
Name: ftsZp4
+1: 104636
Distance from start of the gene: 669
Sequence: gaagatgaacgtgaactgggtgtctgcgtcgtcgatatcggtggtggtacaatggatatcGccgtttataccggtggggca
Note(s): The ftsZp4 promoter is an internal promoter of the ftsQAZ operon.
Evidence: [HIPP]
[TIM]
Reference(s): [8] Aldea M., et al., 1990
[9] Ballesteros M., et al., 1998
[15] Flardh K., et al., 1997
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp activation ftsZp4 ftsQp1, ftsZp4, and ftsZp3 are attractive candidates for ppGpp activation, since they exhibit inverse growth rate regulation. Even so, the effect of ppGpp on the ftsZ gene could be indirect |CITS:[8407846]|. [IMP] [12]
[13]
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [12] Vinella D., et al., 1993
[13] Vinella D., et al., 1993


Transcription unit       
Name: ftsZ
Gene(s): ftsZ   Genome Browser M3D Gene expression COLOMBOS
Evidence: [IEP] Inferred from expression pattern
Reference(s): [15] Flardh K., et al., 1997
Promoter
Name: ftsZp3
+1: 104693
Distance from start of the gene: 612
Sequence: atcgccgtttataccggtggggcattgcgccacactaaggtaattccttatgctggcaatGtcgtgaccagtgatatcgct
Note(s): The ftsZp3 promoter is an internal promoter of the ftsQAZ operon.
Evidence: [HIPP]
[TIM]
Reference(s): [8] Aldea M., et al., 1990
[9] Ballesteros M., et al., 1998
[15] Flardh K., et al., 1997
Allosteric regulation of RNA-polymerase
  Regulator Function Promoter target of RNApol Growth Conditions Note Evidence Reference
  ppGpp activation ftsZp3 ftsQp1, ftsZp4, and ftsZp3 are attractive candidates for ppGpp activation, since they exhibit inverse growth rate regulation. Even so, the effect of ppGpp on the ftsZ gene could be indirect |CITS:[8407846]|. [IMP] [12]
[13]
Evidence: [IMP] Inferred from mutant phenotype
Reference(s): [12] Vinella D., et al., 1993
[13] Vinella D., et al., 1993


Transcription unit       
Name: ftsZ
Gene(s): ftsZ   Genome Browser M3D Gene expression COLOMBOS
Evidence: [IEP] Inferred from expression pattern
Reference(s): [15] Flardh K., et al., 1997
Promoter
Name: ftsZp2
+1: 105045
Distance from start of the gene: 260
Sequence: ccggtggcgcagcgcagatcgaaggtcttgcagcctgtgctcagcgcgtgtttcatacgcAagtgcgtatcggcgcgccgc
Note(s): The ftsZp2 promoter is an internal promoter of the ftsQAZ operon, and it appears to be weak.
Evidence: [HIPP]
[TIM]
Reference(s): [8] Aldea M., et al., 1990
[9] Ballesteros M., et al., 1998
[15] Flardh K., et al., 1997


Transcription unit       
Gene(s): lpxC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: lpxCp1
+1: 106508
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 49
Sequence: gctgattaagaattgactggaatttgggtttcgaggctctttgtgctaaactggcccgccGaatgtatagtacacttcggt
                        -35                    -10          +1                   
Note(s): 554 promoter regions from Escherichia coli were aligned in order to analyze their sequence similarities. Mitchell et al. (2003) Mitchell JE,2003 focused on conservation, patterns, similarities, and differences between promoters with or without an extended -10 5'-TG-3' element and other conserved elements. They experimentally showed that, for several naturally occurring extended -10 promoters, the 5'-TRTG-3' motif is an important determinant for promoter activity. Eleven promoters were selected for further experimental study. Of those, the seven most active (aroF > ompF > envA > purFp1 > purEF > purMN > gyrA) were investigated regarding the contribution of the extended -10 motif by changing the 5'-TG-3' element. Promoters with poor matches to the -10 and -35 consensus hexamers are more dependent on the 5'-TG-3' motif, and this plays a similar role in different promoters. The dinucleotide at -17 and -16 in aroFp results in similar patterns of activity, suggesting that these bases play a similar role in different promoters Mitchell JE,2003.
Evidence: [HIPP]
[NTAS]
Reference(s): [16] Beall B., et al., 1987
[17] Mitchell JE., et al., 2003
Terminator(s)
Type: rho-independent
Sequence: gtataaaattCGACTGGCAAATCTGGCACTCTCTCCGGCCAGGTGAACCAGTCGtttttttttg
Reference(s): [16] Beall B., et al., 1987


Transcription unit       
Gene(s): lpxC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: lpxCp2
+1: 106530
Distance from start of the gene: 27
Sequence: tttgggtttcgaggctctttgtgctaaactggcccgccgaatgtatagtacacttcggttGgataggtaatttggcgagat
Evidence: [HTTIM]    
[RS-EPT-CBR]
Reference(s): [18] Mendoza-Vargas A., et al., 2009
[19] Salgado H, et al., 2012


Regulation by sRNA    
  Small RNA name (Regulator) Regulation type Mechanism Function Binding Sites Evidence Reference
LeftPos RightPos Sequence (RNA-strand)
  dicF antisense translational regulation repressor 105277 105306 GCGACAGGCACAAATCGGAGAGAAACTAT
Notes: "The provided sequence is that of the RNA strand,i.e. 'U's are showed instead the 'T'"




Reference(s)    

 [1] Hara H., Yasuda S., Horiuchi K., Park JT., 1997, A promoter for the first nine genes of the Escherichia coli mra cluster of cell division and cell envelope biosynthesis genes, including ftsI and ftsW., J Bacteriol 179(18):5802-11

 [2] Mengin-Lecreulx D., Ayala J., Bouhss A., van Heijenoort J., Parquet C., Hara H., 1998, Contribution of the Pmra promoter to expression of genes in the Escherichia coli mra cluster of cell envelope biosynthesis and cell division genes., J Bacteriol 180(17):4406-12

 [3] Vicente M., Gomez MJ., Ayala JA., 1998, Regulation of transcription of cell division genes in the Escherichia coli dcw cluster., Cell Mol Life Sci 54(4):317-24

 [4] Gohler AK., Kokpinar O., Schmidt-Heck W., Geffers R., Guthke R., Rinas U., Schuster S., Jahreis K., Kaleta C., 2011, More than just a metabolic regulator - elucidation and validation of new targets of PdhR in Escherichia coli., BMC Syst Biol 5(1):197

 [5] Eraso JM., Markillie LM., Mitchell HD., Taylor RC., Orr G., Margolin W., 2014, The Highly Conserved MraZ Protein Is a Transcriptional Regulator in Escherichia coli., J Bacteriol 196(11):2053-66

 [6] Ishino F., Jung HK., Ikeda M., Doi M., Wachi M., Matsuhashi M., 1989, New mutations fts-36, lts-33, and ftsW clustered in the mra region of the Escherichia coli chromosome induce thermosensitive cell growth and division., J Bacteriol 171(10):5523-30

 [7] Yamamoto K., Yata K., Fujita N., Ishihama A., 2001, Novel mode of transcription regulation by SdiA, an Escherichia coli homologue of the quorum-sensing regulator., Mol Microbiol 41(5):1187-98

 [8] Aldea M., Garrido T., Pla J., Vicente M., 1990, Division genes in Escherichia coli are expressed coordinately to cell septum requirements by gearbox promoters., EMBO J 9(11):3787-94

 [9] Ballesteros M., Kusano S., Ishihama A., Vicente M., 1998, The ftsQ1p gearbox promoter of Escherichia coli is a major sigma S-dependent promoter in the ddlB-ftsA region., Mol Microbiol 30(2):419-30

 [10] Wang XD., de Boer PA., Rothfield LI., 1991, A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli., EMBO J 10(11):3363-72

 [11] Sitnikov DM., Schineller JB., Baldwin TO., 1996, Control of cell division in Escherichia coli: regulation of transcription of ftsQA involves both rpoS and SdiA-mediated autoinduction., Proc Natl Acad Sci U S A 93(1):336-41

 [12] Vinella D., Bouloc P., D'Ari R., 1993, GTPase enters the ring., Curr Biol 3(1):65-6

 [13] Vinella D., Joseleau-Petit D., Thevenet D., Bouloc P., D'Ari R., 1993, Penicillin-binding protein 2 inactivation in Escherichia coli results in cell division inhibition, which is relieved by FtsZ overexpression., J Bacteriol 175(20):6704-10

 [14] Carballes F., Bertrand C., Bouche JP., Cam K., 1999, Regulation of Escherichia coli cell division genes ftsA and ftsZ by the two-component system rcsC-rcsB., Mol Microbiol 34(3):442-50

 [15] Flardh K., Garrido T., Vicente M., 1997, Contribution of individual promoters in the ddlB-ftsZ region to the transcription of the essential cell-division gene ftsZ in Escherichia coli., Mol Microbiol 24(5):927-36

 [16] Beall B., Lutkenhaus J., 1987, Sequence analysis, transcriptional organization, and insertional mutagenesis of the envA gene of Escherichia coli., J Bacteriol 169(12):5408-15

 [17] Mitchell JE., Zheng D., Busby SJ., Minchin SD., 2003, Identification and analysis of 'extended -10' promoters in Escherichia coli., Nucleic Acids Res 31(16):4689-95

 [18] Mendoza-Vargas A., Olvera L., Olvera M., Grande R., Vega-Alvarado L., Taboada B., Jimenez-Jacinto V., Salgado H., Juarez K., Contreras-Moreira B., Huerta AM., Collado-Vides J., Morett E., 2009, Genome-wide identification of transcription start sites, promoters and transcription factor binding sites in E. coli., PLoS One 4(10):e7526

 [19] Salgado H, Peralta-Gil M, Gama-Castro S, Santos-Zavaleta A, Mu¿¿iz-Rascado L, Garc¿¿a-Sotelo JS, Weiss V, Solano-Lira H, Mart¿¿nez-Flores I, Medina-Rivera A, Salgado-Osorio G, Alquicira-Hern¿¿ndez S, Alquicira-Hern¿¿ndez K, L¿¿pez-Fuentes A, Porr¿¿n-Sotelo L, Huerta AM, Bonavides-Mart¿¿nez C, Balderas-Mart¿¿nez YI, Pannier L, Olvera M, Labastida A, Jim¿¿nez-Jacinto V, Vega-Alvarado L, Del Moral-Ch¿¿vez V, Hern¿¿ndez-Alvarez A, Morett E, Collado-Vides J., 2012, RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more., Nucleic Acids Res.


RegulonDB