RegulonDB RegulonDB 10.10: Operon Form
   

patA operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: patA
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: patA
Gene(s): patA   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, GTTAATTATCTTGCCCAAAAATC, in the intergenic region of the divergent genes aer and patA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Transcription of the patA gene is induced under nitrogen-limited growth conditions Schneider BL,2013
and in the presence of putrescine in a growth-dependent manner Schneider BL,2013 Putrescine-dependent expression of the patA gene is controlled by at least two sigma factors: σ38 under excess nitrogen conditions and σ54 under nitrogen starvation conditions Kim YS,2014.
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Samsonova NN., et al., 2003
Promoter
Name: patAp
+1: 3219458
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 36
Sequence: gtgtttatcccgattttcgcgatcgcagccggagtggcgcaatccctgcaatacttaaatCggtatcatgtgatacgcgag
Note(s): Besides the σ54-dependent promoter that directs transcription, another σ38-dependent promoter seems to activate patA transcription. Both promoters initiate transcription at the same nucleotide. Apparently, there is competition between the two sigma factors to bind the promoter. Under nitrogen-limited conditions, σ54 appears be dominant, and σ38 dominates in nitrogen excess Schneider BL,2013
Evidence: [AIPP]
[IEP]
[TIM]
Reference(s): [2] Kim YS., et al., 2014
[1] Samsonova NN., et al., 2003
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis unknown patAp 3219330 3219344 -121.0 tacccgacaaAAACCGTGCAAAATAacaacaaatg nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF unknown patAp 3219196 3219208 -256.0 tttaaacacaAATCTAATTCCTTgatttaaaat nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NtrC-phosphorylated activator patAp 3218907 3218924 -543.0 atccgggtgaCGCACCATGTTGTGCGGCtgcccttgta nd [IEP], [AIBSCS] [3]
remote NtrC-phosphorylated activator patAp 3219257 3219273 -193.0 ttaattatctTGCCCAAAAATCAGGCAattattgccc nd [GEA], [AIBSCS] [1], [4]
remote NtrC-phosphorylated activator patAp 3219279 3219295 -171.0 aggcaattatTGCCCTGAAAACGTGCAtttgcgcagc nd [GEA], [AIBSCS] [1], [4]


Transcription unit          
Name: patA
Gene(s): patA   Genome Browser M3D Gene expression COLOMBOS
Note(s): J. Oberto in 2010 identified a possible binding site for NagC, GTTAATTATCTTGCCCAAAAATC, in the intergenic region of the divergent genes aer and patA. This demonstration was based on different statistical methods Oberto J.,2010 but it is not known if NagC regulates transcription in both directions.
Transcription of the patA gene is induced under nitrogen-limited growth conditions Schneider BL,2013
and in the presence of putrescine in a growth-dependent manner Schneider BL,2013 Putrescine-dependent expression of the patA gene is controlled by at least two sigma factors: σ38 under excess nitrogen conditions and σ54 under nitrogen starvation conditions Kim YS,2014.
Evidence: [BTEI] Boundaries of transcription experimentally identified
Reference(s): [1] Samsonova NN., et al., 2003
Promoter
Name: patAp2
+1: 3219458
Sigma Factor: Sigma54 Sigmulon
Distance from start of the gene: 36
Sequence: gtgtttatcccgattttcgcgatcgcagccggagtggcgcaatccctgcaatacttaaatCggtatcatgtgatacgcgag
                                   -24         -12          +1                   
Note(s): Besides the σ54-dependent promoter that directs transcription, another σ38-dependent promoter seems to activate patA transcription. Both promoters initiate transcription at the same nucleotide. Apparently, there is competition between the two sigma factors to bind the promoter. Under nitrogen-limited conditions, σ54 appears be dominant, and σ38 dominates in nitrogen excess Schneider BL,2013
Evidence: [AIPP]
[ICWHO]
[IEP]
[TIM]
Reference(s): [5] Huerta AM., et al., 2003
[2] Kim YS., et al., 2014
[1] Samsonova NN., et al., 2003
[4] Schneider BL., et al., 2013
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote Fis unknown patAp2 3219330 3219344 -121.0 tacccgacaaAAACCGTGCAAAATAacaacaaatg nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote IHF unknown patAp2 3219196 3219208 -256.0 tttaaacacaAATCTAATTCCTTgatttaaaat nd [AIBSCS] [1]
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
remote NtrC-phosphorylated activator patAp2 3218907 3218924 -543.0 atccgggtgaCGCACCATGTTGTGCGGCtgcccttgta nd [IEP], [AIBSCS] [3]
remote NtrC-phosphorylated activator patAp2 3219257 3219273 -193.0 ttaattatctTGCCCAAAAATCAGGCAattattgccc nd [GEA], [AIBSCS] [1], [4]
remote NtrC-phosphorylated activator patAp2 3219279 3219295 -171.0 aggcaattatTGCCCTGAAAACGTGCAtttgcgcagc nd [GEA], [AIBSCS] [1], [4]





RegulonDB