RegulonDB RegulonDB 10.10: Operon Form
   

ldtC operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: ldtC
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: ldtC
Gene(s): ldtC   Genome Browser M3D Gene expression COLOMBOS
Evidence: [ICWHO] Inferred computationally without human oversight
Promoter
Name: ldtCp
+1: 1170417
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 43
Sequence: ttacaaattctttgcacttccctgcactatccgacactgtcaccatccataattcaggctTatctgtttattacaataacc
                      -35                       -10         +1                   
Evidence: [HIPP]
[ICWHO]
[TIM]
Reference(s): [1] Huerta AM., et al., 2003
[2] Yamamoto K., et al., 2006
TF binding sites (TFBSs)
[CpxR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated activator ldtCp 1170463 1170479 -53.5 catctgcaacATTTACAAATTCTTTGCacttccctgc nd [APIORCISFBSCS], [BPP] [2]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA MicA ldtC repressor 1170356 1170383 AACGCGUUUUGAUCAUCACCAAAAAUCC nd [IEP] [3]


Evidence    

 [HIPP] Human inference of promoter position

 [ICWHO] Inferred computationally without human oversight

 [TIM] Transcription initiation mapping

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [IEP] Inferred from expression pattern


Reference(s)    

 [1] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [2] Yamamoto K., Ishihama A., 2006, Characterization of copper-inducible promoters regulated by CpxA/CpxR in Escherichia coli., Biosci Biotechnol Biochem 70(7):1688-95

 [3] Gogol EB., Rhodius VA., Papenfort K., Vogel J., Gross CA., 2011, Small RNAs endow a transcriptional activator with essential repressor functions for single-tier control of a global stress regulon., Proc Natl Acad Sci U S A 108(31):12875-80

RegulonDB