RegulonDB RegulonDB 10.10: Operon Form

yqaE-kbp operon and associated TUs in Escherichia coli K-12 genome

Name: yqaE-kbp
This page displays every known transcription unit of this operon and their known regulation.

Transcription unit       
Name: kbp
Gene(s): kbp   Genome Browser M3D Gene expression COLOMBOS
Note(s): Under NlpE outer membrane lipoprotein overexpression, the transcription of the ygaU gene is increased by CpxR Raivio TL,2013.
Evidence: [ICWHO] Inferred computationally without human oversight
Name: kbpp4
+1: 2796814
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 28
Sequence: attaaacctgtgctcatccccgcggcgttaacgcgccgcgttcctctgctacactttctgAgtgtttccgttaacgaatga
                                                -10         +1                   
Evidence: [ICWHO]
Reference(s): [1] Huerta AM., et al., 2003

Transcription unit          
Name: yqaE
Gene(s): yqaE   Genome Browser M3D Gene expression COLOMBOS
Note(s): Under NlpE outer membrane lipoprotein overexpression, the transcription of the yqaE gene is increased by CpxR Raivio TL,2013
Evidence: [ICWHO] Inferred computationally without human oversight
[LTED] Length of transcript experimentally determined
Reference(s): [2] De Lay N., et al., 2009
Name: yqaEp
+1: 2797085
Distance from start of the gene: 57
Sequence: gcagcgtaaatgagagtaaaagcgtaagctgaaactggcaggctccgctaaaattactacGcttaagagataaaatctctt
Evidence: [TIM]
Reference(s): [2] De Lay N., et al., 2009
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated activator yqaEp 2797126 2797141 -48.0 gcctcagcagCGTAAATGAGAGTAAAagcgtaagct nd [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [3], [4], [5]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA CyaR yqaE repressor 2797013 2797032 UUCUCCAGAAACCCAUAUGU nd [GEA], [SM] [2]

Transcription unit          
Name: yqaE-kbp
Gene(s): kbp, yqaE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [PM] Polar mutation
Reference(s): [3] Bernal-Cabas M., et al., 2015
Name: yqaEp
+1: 2797085
Distance from start of the gene: 57
Sequence: gcagcgtaaatgagagtaaaagcgtaagctgaaactggcaggctccgctaaaattactacGcttaagagataaaatctctt
Evidence: [TIM]
Reference(s): [2] De Lay N., et al., 2009
TF binding sites (TFBSs)
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated activator yqaEp 2797126 2797141 -48.0 gcctcagcagCGTAAATGAGAGTAAAagcgtaagct nd [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [3], [4], [5]
