RegulonDB RegulonDB 11.2: Operon Form
   

yqaE-kbp operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: yqaE-kbp
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit       
Name: kbp
Gene(s): kbp   Genome Browser M3D Gene expression COLOMBOS
Note(s): Under NlpE outer membrane lipoprotein overexpression, the transcription of the ygaU gene is increased by CpxR Raivio TL,2013.
Evidence: [COMP-AINF] Inferred computationally without human oversight
Promoter
Name: kbpp4
+1: 2796814
Sigma Factor: Sigma38 Sigmulon
Distance from start of the gene: 28
Sequence: attaaacctgtgctcatccccgcggcgttaacgcgccgcgttcctctgctacactttctgAgtgtttccgttaacgaatga
                                                       -10  +1                   
Evidence: [COMP-AINF]
Reference(s): [1] Huerta AM., et al., 2003


Transcription unit          
Name: yqaE-kbp
Gene(s): kbp, yqaE   Genome Browser M3D Gene expression COLOMBOS
Evidence: [EXP-IMP-POLAR-MUTATION] Polar mutation
Reference(s): [2] Bernal-Cabas M., et al., 2015
Promoter
Name: yqaEp
+1: 2797085
Distance from start of the gene: 57
Sequence: gcagcgtaaatgagagtaaaagcgtaagctgaaactggcaggctccgctaaaattactacGcttaagagataaaatctctt
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [3] De Lay N., et al., 2009
TF binding sites (TFBSs)
[CpxR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated activator yqaEp 2797126 2797141 -48.0 gcctcagcagCGTAAATGAGAGTAAAagcgtaagct nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2], [4], [5]


Transcription unit          
Name: yqaE
Gene(s): yqaE   Genome Browser M3D Gene expression COLOMBOS
Note(s): Under NlpE outer membrane lipoprotein overexpression, the transcription of the yqaE gene is increased by CpxR Raivio TL,2013
Evidence: [COMP-AINF] Inferred computationally without human oversight
[EXP-IDA-TRANSCRIPT-LEN-DETERMINATION] Length of transcript experimentally determined
Reference(s): [3] De Lay N., et al., 2009
Promoter
Name: yqaEp
+1: 2797085
Distance from start of the gene: 57
Sequence: gcagcgtaaatgagagtaaaagcgtaagctgaaactggcaggctccgctaaaattactacGcttaagagataaaatctctt
Evidence: [EXP-IDA-TRANSCRIPTION-INIT-MAPPING]
Reference(s): [3] De Lay N., et al., 2009
TF binding sites (TFBSs)
[CpxR,+] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal CpxR-phosphorylated activator yqaEp 2797126 2797141 -48.0 gcctcagcagCGTAAATGAGAGTAAAagcgtaagct nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [COMP-AINF-SIMILAR-TO-CONSENSUS], [COMP-HINF-SIMILAR-TO-CONSENSUS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2], [4], [5]
sRNA Interaction TU
sRNA TU Regulated Function Binding Sites Regulatory Mechanism Evidence (Confirmed, Strong, Weak) Reference(s)
PosLeft PosRight Target sequence (mRNA)
small regulatory RNA CyaR yqaE repressor 2797013 2797032 UUCUCCAGAAACCCAUAUGU nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IMP-SITE-MUTATION] [3]


Evidence    

 [COMP-AINF] Inferred computationally without human oversight

 [EXP-IDA-TRANSCRIPTION-INIT-MAPPING] Transcription initiation mapping

 [EXP-IEP-GENE-EXPRESSION-ANALYSIS] Gene expression analysis

 [COMP-AINF-SIMILAR-TO-CONSENSUS] Automated inference based on similarity to consensus sequences

 [COMP-HINF-SIMILAR-TO-CONSENSUS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] Binding of purified proteins

 [EXP-IMP-SITE-MUTATION] Site mutation


Reference(s)    

 [1] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [2] Bernal-Cabas M., Ayala JA., Raivio TL., 2015, The Cpx Envelope Stress Response Modifies Peptidoglycan Cross-Linking via the l,d-Transpeptidase LdtD and the Novel Protein YgaU., J Bacteriol 197(3):603-14

 [3] De Lay N., Gottesman S., 2009, The Crp-activated small noncoding regulatory RNA CyaR (RyeE) links nutritional status to group behavior., J Bacteriol 191(2):461-76

 [4] Raivio TL., Leblanc SK., Price NL., 2013, The Escherichia coli Cpx envelope stress response regulates genes of diverse function that impact antibiotic resistance and membrane integrity., J Bacteriol 195(12):2755-67

 [5] Vogt SL., Evans AD., Guest RL., Raivio TL., 2014, The Cpx envelope stress response regulates and is regulated by small noncoding RNAs., J Bacteriol 196(24):4229-38

RegulonDB