|
|
| Operon |  |
|---|---|
| Name: | sdhCDAB-sucABCD-sdhX |
| This page displays every known transcription unit of this operon and their known regulation. | |
| Name: | sdhCDAB-sucABCD-sdhX | |||||||||
| Synonym(s): | OP00142, sdhCDAB, sdhCDAB-sucABCD, sucABCD | |||||||||
| Gene(s): | sdhC, sdhD, sdhA, sdhB, sucA, sucB, sucC, sucD, sdhX Genome Browser M3D Gene expression COLOMBOS | |||||||||
| Note(s): | Detection of the full-length sdhCDAB-sucABCD-sdhX transcript, albeit only in rnc and rne mutants, has now established that eight genes encoding three citric acid cycle enzymes are cotranscribed from the sdh promoter. The operon contains one internal promoter (Psuc) and appears to contain two regios of RNAse processing, one located in the sdhB-sucA intergenic region and the other located upstream of sdhX Miyakoshi M,2019. De Mets F,2019. sdhCDAB, sucAB, and sucCD form a cluster containing two promoters. Transcription of the sucABCD genes is primarily initiated and regulated at the upstream sdh promoter. Direct evidence for cotranscription of the entire sdhCDAB-sucABCD region from Psdh was obtained by detecting a 10-kb transcript in rnc and rse mutants. sdh and suc genes belong to a single operon. The absence of a CRP-binding site in the suc promoter region was used to support the early suggestion that the sdh and suc genes are cotranscribed. Under nitrogen-rich growth conditions, the expression of the sdhC gene increased in mutants for two genes that encode two terminal oxidases, cyoA and cydB, and in mutants for two transcriptional regulators, Fnr and Fur. However, under nitrogen-limited growth conditions, gene expression was decreased Kumar R,2011. The expression of this operon is enhanced during and after the switch from aerobic to anaerobic growth conditions 21980479. The expression of the gene sdhC is decreased under acidic growth conditions in either aerobiosis or microaerobiosis Marzan LW,2013. DcuR appears to affect the expression of sdhC in response to fumarate; however, no site to bind DcuR was located around the sdhCp promoter Surmann K,2020. In a study where it was shown that the L-tryptophan eradicated persister cells, it was observed that the exogenous amino acid decreased the expression of the sucA and sdhD genes 31271063. The sdh genes are downregulated by long-term (8 to 12 h) exposure of E. coli to some biocides 32385082. Based on DNA microarray analysis, the mechanism of bacterial inactivation by carvacrol and citral was studied 28644990. Treatment by both compounds caused membrane damage and activated metabolism through the production of nucleotides required for DNA and RNA synthesis and metabolic processes 28644990. A total of 76 and 156 genes demonstrated significant transcriptional differences by carvacrol and citral, respectively. Genes upregulated by carvacrol treatment included the multidrug efflux pump genes acrA and mdtM, genes related to the phage shock response, pspA, pspB, pspC, pspD, pspF, and pspG, and genes whose products are important for biosynthesis of arginine (argC, argG, artJ) and purine nucleotides (purC, purM). Genes upregulated by citral treatment included purH, pyrB, and pyrI. On the other hand, mutations in several differentially expressed genes confirmed the roles of ygaV, yjbO, pspC, sdhA, yejG, and ygaV in mechanisms of inactivation by carvacrol and citral 28644990. |
|||||||||
| Evidence: | [LTED] Length of transcript experimentally determined | |||||||||
| Reference(s): |
[1] Cunningham L., et al., 1998 [2] Magnusson K., et al., 1986 [3] Wood D., et al., 1984 |
|||||||||
| Promoter | ||||||||||
| Name: | sdhCp | |||||||||
| +1: | 754958 | |||||||||
| Sigma Factor: | Sigma70 Sigmulon | |||||||||
| Distance from start of the gene: | 219 | |||||||||
| Sequence: |
cgacaaactatatgtaggttaattgtaatgattttgtgaacagcctatactgccgccaggTctccggaacaccctgcaatc -35 -10 +1 |
|||||||||
| Evidence: |
[HIPP] [ICWHO] [TIM] |
|||||||||
| Reference(s): |
[4] Huerta AM., et al., 2003 [5] Wilde RJ., et al., 1986 |
|||||||||
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| remote | ArcA-Phosphorylated | activator | sdhCp | 754740 | 754754 | -211.0 | tgttacataaGTTAATCTTAGGTGAAataccgactt | nd | [APIORCISFBSCS], [GEA] | nd |
| remote | ArcA-Phosphorylated | activator | sdhCp | 754814 | 754828 | -137.0 | ttgtaacaacTTTGTTGAATGATTGTcaaattagat | nd | [BPP], [GEA] | [9] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | ArcA-Phosphorylated | repressor | sdhCp | 754919 | 754933 | -32.0 | atgtaggttaATTGTAATGATTTTGTgaacagccta | nd | [APIORCISFBSCS], [BPP], [GEA] | [15], [16] |
| proximal | ArcA-Phosphorylated | repressor | sdhCp | 754924 | 754938 | -27.0 | ggttaattgtAATGATTTTGTGAACAgcctatactg | nd | [APIORCISFBSCS], [GEA] | [9], [15] |
| remote | ArcA-Phosphorylated | repressor | sdhCp | 755207 | 755221 | 257.0 | acaaagacctGTTAATCTGGACCTACagaccatccg | nd | [BPP], [GEA] | [9] |
| Type | Transcription factor | Function | Promoter | Binding Sites | Growth Conditions | Evidence (Confirmed, Strong, Weak) | Reference(s) | |||
|---|---|---|---|---|---|---|---|---|---|---|
| LeftPos | RightPos | Central Rel-Pos | Sequence | |||||||
| proximal | CRP-cAMP1 | activator | sdhCp | 754864 | 754886 | -83.5 | taaatgttgtTATCGTGACCTGGATCACTGTTCaggataaaac | nd | [AIBSCS], [BCE], [GEA] | [10], [11], [12], [13] |
| Note(s): |
1Early work with an sdh-galk fusion indicates that crp and cya are required for maximum expression, and S1 mapping studies not only confirmed that sdh transcription is severely repressed by glucose but indicated that there is a potential CRP-binding site at -80 in the sdh promoter region. This promoter and its CRP-binding site are responsible for the coordinate expression and the glucose-mediated repression of ODH and SCS synthesis.3Early work with an sdh-galk fusion indicates that crp and cya are required for maximum expression, and S1 mapping studies not only confirmed that sdh transcription is severely repressed by glucose but indicated that there is a potential CRP-binding site at -80 in the sdh promoter region. This promoter and its CRP-binding site are responsible for the coordinate expression and the glucose-mediated repression of ODH and SCS synthesis. |
| sRNA | TU Regulated | Function | Binding Sites | Regulatory Mechanism | Evidence (Confirmed, Strong, Weak) | Reference(s) | ||
|---|---|---|---|---|---|---|---|---|
| PosLeft | PosRight | Target sequence (mRNA) | ||||||
| small regulatory RNA RyhB | sdhCDAB-sucABCD-sdhX | repressor | 755518 | 755557 | UGUUAUUACUGUCGUGCUUUCACUUCUCGCAGGAGUCCUC | MRNA-DEGRADATION | [IMP], [IPI] | [6], [7] |
| small regulatory RNA RyhB | sdhCDAB-sucABCD-sdhX | repressor | 755162 | 755170 | AUGUGGGCG | MRNA-DEGRADATION | [IEP], [IPI], [SM] | [8] |
| Name: | sdhDAB |
| Gene(s): | sdhD, sdhA, sdhB Genome Browser M3D Gene expression COLOMBOS |
| Note(s): | A transcript that contains sdhA and sdhB is decreased after σE induction, as observed in high-throughput analysis of gene expression Lacoux C,2020. |
| Evidence: | [BTEI] Boundaries of transcription experimentally identified |
| Reference(s): |
[18] Spencer ME., et al., 1985 [5] Wilde RJ., et al., 1986 |
| Promoter | |
| Name: | sdhDp2 |
| +1: | 755404 |
| Sigma Factor: | Sigma70 Sigmulon |
| Distance from start of the gene: | 156 |
| Sequence: |
aggtttcgagcaagcttccgcgattatgggcagcttcttcgtcaaatttatcatgtggggCatccttaccgctctggcgta -35 -10 +1 |
| Note(s): | The sdh promoters generate two polycistronic mRNAs, a long 3,493-base sdhCDAB transcript (p1) and a shorter 3,047-base sdhDAB transcript (p2). sdhDAB (major), 1,455 bp upstream of sdhD (i.e., within sdhC) TGGGCA/16bp/TATCAT (P2 positions 1284-1311) sdhDp 156 bp upstream from the sdhD gene TGGGCA/16bp/TATCAT 7 bp upstream. Note that the operation of alternative σ-type promoters cannot be ruled out. |
| Evidence: |
[HIPP] [ICWHO] [TIM] |
| Reference(s): |
[4] Huerta AM., et al., 2003 [5] Wilde RJ., et al., 1986 |
| Terminator(s) | |
| Type: | rho-dependent |
| Sequence: | tcgcatcaggCAACCAGtgccggatgc |
| Reference(s): | [18] Spencer ME., et al., 1985 |
| Name: | sucABCD |
| Synonym(s): | OP00143, suc |
| Gene(s): | sucA, sucB, sucC, sucD Genome Browser M3D Gene expression COLOMBOS |
| Note(s): | The sucAB genes are flanked by three and four REP sequences. ArcA appears to repress sucD gene expression under anaerobiosis. Two putative ArcA binding sites were identified 69, 267 and 330 bp upstream of this gene Salmon KA,2005, but no promoter upstream of it has been identified. Instead, sucD is transcribed from two promoters one of them is located usptream of sdhC gene and the other one upstream of sucA gene. The sdhCp promoter is repressed by ArcA. Disruption of the sucA and sucB genes notably decrease survival under high hydrostatic pressure (HHP). On the other hand, disruption of the sucC and sucD genes increase resistance to high hydrostatic pressure (HHP). This disruption was mediated by increased basal RpoS activity levels, although the activity levels did not correlate with the changes in heat resistance 30497599 TCA cycle enzymes can profoundly affect HHP resistance 30497599 |
| Evidence: | [LTED] Length of transcript experimentally determined |
| Reference(s): |
[19] Buck D., et al., 1989 [20] Buck D., et al., 1986 [1] Cunningham L., et al., 1998 |
| Promoter | |
| Name: | sucAp |
| +1: | 758586 |
| Sigma Factor: | Sigma38 Sigmulon |
| Distance from start of the gene: | 120 |
| Sequence: |
cgtaacaaagaaatgcaggaaatctttaaaaactgcccctgacactaagacagtttttaaAggttccttcgcgagccacta -35 -10 +1 |
| Note(s): | There is a single suc promoter upstream of the sucA gene, and transcription continues between the sucAB and sucCD genes; no independent transcription of the sucCD genes has been detected. Expression from the suc promoter was partially activated by σ38. sucAp appears to be repressed by CRP, although no CRP site has been found. The significance of this 2-fold repression is obscure. |
| Evidence: |
[ICWHO] [TIM] |
| Reference(s): |
[1] Cunningham L., et al., 1998 [4] Huerta AM., et al., 2003 [18] Spencer ME., et al., 1985 |
| Note(s): | 1Expression from the suc promoter was repressed by IHF. The consequences of inactivating other potential regulators showed that IHF performs a major role in repressing the suc promoter may be initiated by σ38.3Expression from the suc promoter was repressed by IHF. The consequences of inactivating other potential regulators showed that IHF performs a major role in repressing the suc promoter may be initiated by σ38. |
| Name: | sucAB |
| Gene(s): | sucA, sucB Genome Browser M3D Gene expression COLOMBOS |
| Evidence: | [BTEI] Boundaries of transcription experimentally identified |
| Reference(s): |
[1] Cunningham L., et al., 1998 [18] Spencer ME., et al., 1985 |
| Promoter | |
| Name: | sucAp |
| +1: | 758586 |
| Sigma Factor: | Sigma38 Sigmulon |
| Distance from start of the gene: | 120 |
| Sequence: |
cgtaacaaagaaatgcaggaaatctttaaaaactgcccctgacactaagacagtttttaaAggttccttcgcgagccacta -35 -10 +1 |
| Note(s): | There is a single suc promoter upstream of the sucA gene, and transcription continues between the sucAB and sucCD genes; no independent transcription of the sucCD genes has been detected. Expression from the suc promoter was partially activated by σ38. sucAp appears to be repressed by CRP, although no CRP site has been found. The significance of this 2-fold repression is obscure. |
| Evidence: |
[ICWHO] [TIM] |
| Reference(s): |
[1] Cunningham L., et al., 1998 [4] Huerta AM., et al., 2003 [18] Spencer ME., et al., 1985 |
| Terminator(s) | |
| Type: | rho-dependent |
| Sequence: | aagcgatacgAAATATTCggtctacggt |
| Reference(s): | [18] Spencer ME., et al., 1985 |
| Note(s): | 1Expression from the suc promoter was repressed by IHF. The consequences of inactivating other potential regulators showed that IHF performs a major role in repressing the suc promoter may be initiated by σ38.3Expression from the suc promoter was repressed by IHF. The consequences of inactivating other potential regulators showed that IHF performs a major role in repressing the suc promoter may be initiated by σ38. |
| Reference(s) |
|
|---|---|
[HIPP] Human inference of promoter position