RegulonDB RegulonDB 11.0: Operon Form
   

nfeF operon and associated TUs in Escherichia coli K-12 genome




Operon      
Name: nfeF
This page displays every known transcription unit of this operon and their known regulation.


Transcription unit          
Name: nfeF
Synonym(s): yqjH
Gene(s): nfeF   Genome Browser M3D Gene expression COLOMBOS
Note(s): FUR is a regulator that binds cooperatively, on different faces of the DNA Chen Z,2007. Lavrrar JL, McIntosh MA,2003, in the promoter regions; according to the sequence identified by Wang et al. in 2011 (GATTAACAATCATTATCATTT), it is possible that this regulator interacts with three binding sites in different positions Wang S,2011.
A potential RNA G-quadruplex structure, formed by guanine-rich sequences located in the coding sequence region of the gene, was identified for nfeF . This structure could regulate the expression of the gene, as observed for hemL gene expression Shao X, Zhang W, Umar MI, Wong HY, Seng Z, Xie Y, Zhang Y, Yang L, Kwok CK, Deng X,2020.
It was determined by Genomic SELEX screening that the intergenic region of the bidirectional genes nfeF and nfeR is a target of the transcription factor PepA Shimada T,2021.
Evidence: [AISGDTU] Automated inference that a single-gene directon is a transcription unit
Reference(s): [1] Panina EM., et al., 2001
Promoter
Name: yqjHp
+1: 3216538
Sigma Factor: Sigma70 Sigmulon
Distance from start of the gene: 47
Sequence: tagacatatcagttctacaaatcgcttgcatttatcatgattaacaatcattatcatttgCgagttttatttagatatatc
                          -35                       -10     +1                   
Evidence: [HIPP]
[ICWHO]
[IHBCE]
Reference(s): [2] Huerta AM., et al., 2003
[3] Wang S., et al., 2011
TF binding sites (TFBSs)
[Fur,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal Fur-Fe2+ repressor yqjHp 3216538 3216556 -9.0 tatcatgattAACAATCATTATCATTTGCgagttttatt nd [GEA], [AIBSCS], [APIORCISFBSCS] [3], [4]
proximal Fur-Fe2+ repressor yqjHp 3216544 3216562 -15.0 tgcatttatcATGATTAACAATCATTATCatttgcgagt nd [GEA], [AIBSCS], [APIORCISFBSCS] [3], [4]
proximal Fur-Fe2+ repressor yqjHp 3216548 3216566 -19.0 cgcttgcattTATCATGATTAACAATCATtatcatttgc nd [GEA], [AIBSCS], [APIORCISFBSCS] [3], [4]
[NfeR,-] Phrase
Type Transcription factor Function Promoter Binding Sites Growth Conditions Evidence (Confirmed, Strong, Weak) Reference(s)
LeftPos RightPos Central Rel-Pos Sequence
proximal NfeR repressor yqjHp 3216512 3216531 18.0 ttgcgagtttTATTTAGATATATCTGATTAccatcacgaa nd [GEA], [APIORCISFBSCS], [BPP], [SM] [3], [5]


Evidence    

 [HIPP] Human inference of promoter position

 [ICWHO] Inferred computationally without human oversight

 [IHBCE] Inferred by a human based on computational evidence

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [SM] Site mutation


Reference(s)    

 [1] Panina EM., Mironov AA., Gelfand MS., 2001, Comparative analysis of FUR regulons in gamma-proteobacteria., Nucleic Acids Res 29(24):5195-206

 [2] Huerta AM., Collado-Vides J., 2003, Sigma70 promoters in Escherichia coli: specific transcription in dense regions of overlapping promoter-like signals., J Mol Biol 333(2):261-78

 [3] Wang S., Wu Y., Outten FW., 2011, Fur and the novel regulator YqjI control transcription of the ferric reductase gene yqjH in Escherichia coli., J Bacteriol 193(2):563-74

 [4] McHugh JP., Rodriguez-Quinones F., Abdul-Tehrani H., Svistunenko DA., Poole RK., Cooper CE., Andrews SC., 2003, Global iron-dependent gene regulation in Escherichia coli. A new mechanism for iron homeostasis., J Biol Chem 278(32):29478-86

 [5] Wang S., Blahut M., Wu Y., Philipkosky KE., Outten FW., 2014, Communication between binding sites is required for YqjI regulation of target promoters within the yqjH-yqjI intergenic region., J Bacteriol 196(17):3199-207

RegulonDB