RegulonDB RegulonDB 10.6.3:Regulon Page
   

Rob DNA-binding transcriptional dual regulator

Synonyms: Rob
Summary:
Rob is a transcriptional dual regulator. Its N-terminal domain shares 49% identity with MarA and SoxS [16] These proteins activate a common set of about 50 target genes [3, 17, 18, 19] the marA/soxS/rob regulon, involved in antibiotic resistance [1, 20, 21] superoxide resistance [7, 22, 23] and tolerance to organic solvents [24, 25]and heavy metals [26] The activity of each protein is induced by different signals: the activity of Rob is increased with dipyridyl, bile salts, or decanoate [4, 27] and the activities of MarA and SoxS are increased by the aromatic weak acid salicylate [19]and oxidative stress [28] respectively.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
Rob Functional   [IE] [1], [2]
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: rob
  Genome position: 4634441-4635310
  Length: 870 bp / 289 aa
Operon name: rob
TU(s) encoding the TF:
Transcription unit        Promoter
rob
robp


Regulon       
Regulated gene(s) acnA, acrA, acrB, acrZ, aldA, aslB, fumC, inaA, ldtB, marA, marB, marR, micF, mltF, nfo, nfsA, nfsB, rimK, rob, sodA, tolC, ybjC, ybjN, ygiB, ygiC, zwf
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
drug resistance/sensitivity (7)
adaptations (3)
Transcription related (3)
detoxification (3)
TCA cycle (2)
Read more >
Regulated operon(s) acrAB, acrZ, aldA, aslB, fumAC, inaA, ldtB, marRAB, micF, mltF, nfo, nfsB, rob, sodA, tolC-ygiBC, ybjC-nfsA-rimK-ybjN, ymiC-acnA, zwf
First gene in the operon(s) acnA, acrA, aldA, aslB, fumC, inaA, ldtB, marR, micF, mltF, nfo, nfsB, rob, sodA, tolC, tolC, ybjC, zwf, acrZ
Simple and complex regulons AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS
AcrR,EnvR,MarA,MprA,PhoP,Rob,SoxS
AcrR,H-NS,HU,IHF,Lrp,MarA,OmpR,Rob,SoxS
ArcA,CRP,Cra,FNR,MarA,Rob,SoxS
ArcA,CRP,DnaA,FNR,MarA,Rob,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[Rob,+](18)
[Rob,-](1)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  Rob activator acnAp2 Sigma70 -51.5 -101.0 acnA
aaggtttctcCTCTTTTATCAATTTGGGTTGttatcaaatc
1335720 1335740 [GEA], [HIBSCS] [3]
  Rob activator acrAp Sigma70 nd nd acrA, acrB nd nd [BPP], [GEA] [4]
  Rob activator acrZp Sigma70 -40.5 -62.5 acrZ
cgcaaagctgACCGCACAAAAGGGGAGTGCttttctgtgc
794701 794720 [GEA], [IHBCE] [5]
  Rob activator aldAp Sigma70 -161.0 -203.5 aldA
gcgatggaaaGTCGCTCGTTACGTTAAAAAttgcccgttt
1488019 1488038 [AIBSCS], [GEA] [3]
  Rob activator aslBp Sigma54 nd nd aslB nd nd [GEA] [6]
  Rob activator fumCp1 Sigma70 -35.5 -101.5 fumC
gtttttttacATGGCACGAAAGACCAAACAtttgttatca
1686680 1686699 [BPP], [GEA], [IEP] [7], [8]
  Rob activator inaAp Sigma70 -41.5 -68.5 inaA
attcattaatACGACACGTTTCATTAAGATtttcctcagg
2349531 2349550 [BPP], [GEA], [HIBSCS] [6], [9]
  Rob activator ldtBp nd nd nd ldtB nd nd [GEA] [6]
  Rob activator marRp Sigma70 -61.5 -88.5 marR, marA, marB
acttgaaccgATTTAGCAAAACGTGGCATCggtcaattca
1619022 1619041 [BPP], [GEA], [HIBSCS], [SM] [6], [9], [10]
  Rob activator micFp Sigma38, Sigma70 -40.0 -40.5 micF
aagtatttgaCAGCACTGAATGTCAAAACAaaaccttcac
2313034 2313053 [BPP], [GEA], [HIBSCS] [11]
  Rob activator mltFp Sigma70 nd nd mltF nd nd [GEA] [6]
  Rob activator nfop Sigma70 -38.5 -72.5 nfo
tcaaagcgtcATCGCATAAACCACTACATCttgctcctgt
2250758 2250777 [GEA], [HIBSCS] [1], [9]
  Rob activator nfsBp Sigma70 -43.5 -73.0 nfsB
agcggaaatcTATAGCGCATTTTTCTCGCTTaccatttctc
605487 605507 [GEA], [HIBSCS] [3]
  Rob repressor robp nd -19.5 -62.5 rob
actgaatgctAAAACAGCAAAAAATGCTATtatccaatta
4635363 4635382 [BPP], [GEA], [HIBSCS] [12]
  Rob activator sodAp Sigma70 -40.5 -91.5 sodA
tacgaaaagtACGGCATTGATAATCATTTTcaatatcatt
4100709 4100728 [HIBSCS] [1]
  Rob activator tolCp3 nd -40.5 -93.0 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTTttgcggtagc
3178012 3178032 [AIBSCS], [GEA] [13], [14], [15]
  Rob activator tolCp4 Sigma38 -52.5 -93.0 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTTttgcggtagc
3178012 3178032 [AIBSCS], [GEA] [13], [14], [15]
  Rob activator ybjCp Sigma70 -40.5 -61.5 ybjC, nfsA, rimK, ybjN
ttaattgctaAAAGCTATAACTGTTAAACAcaatacagtg
890842 890861 [GEA], [HIBSCS] [3]
  Rob activator zwfp Sigma70 -54.0 -115.5 zwf
gcttttcccgTAATCGCACGGGTGGATAAGcgtttacagt
1936420 1936439 [BPP] [1], [7]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  Rob activator nd nd nd 3303372 3303391 nd [AIBSCS], [GEA] [3]
  Rob activator nd nd nd 189597 189616 nd [AIBSCS], [GEA] [3]
  Rob activator nd nd nd 3172452 3172471 nd [AIBSCS], [GEA] [3]


Alignment and PSSM for Rob TFBSs    

Aligned TFBS of Rob   
  Sequence
  AGGTTGGCGTTACGTGCCATAGG
  GTTTTGACATTCAGTGCTGTCAA
  GATTTAGCAAAACGTGGCATCGG
  TGTTTGGTCTTTCGTGCCATGTA
  ATAATAGCATTTTTTGCTGTTTT
  CGCTTATCCACCCGTGCGATTAC
  ATCTTAATGAAACGTGTCGTATT
  TTTTTAACGTAACGAGCGACTTT
  CTTTTATCAATTTGGGTTGTTAT
  GCACTCCCCTTTTGTGCGGTCAG
  GATGTAGTGGTTTATGCGATGAC
  TGTTTAACAGTTATAGCTTTTAG
  AAAATGATTATCAATGCCGTACT
  AAGCGAGAAAAATGCGCTATAGA

Position weight matrix (PWM). Rob matrix-quality result   
A	5	4	3	2	0	9	5	1	6	6	4	5	3	2	2	0	0	0	7	0	4	6	3
C	2	1	2	2	0	1	1	9	3	0	1	3	6	0	1	0	11	5	0	1	3	1	2
G	4	4	2	1	1	4	6	0	4	2	0	0	0	10	1	14	1	4	6	0	2	3	4
T	3	5	7	9	13	0	2	4	1	6	9	6	5	2	10	0	2	5	1	13	5	4	5

Consensus   
;	consensus.strict             	ggttTagCaattcGtGCcgTtag
;	consensus.strict.rc          	CTAACGGCACGAATTGCTAAACC
;	consensus.IUPAC              	rkttTrrCvwthyGtGCbrTyrk
;	consensus.IUPAC.rc           	MYRAYVGCACRDAWBGYYAAAMY
;	consensus.regexp             	[ag][gt]ttT[ag][ag]C[acg][at]t[act][ct]GtGC[cgt][ag]T[ct][ag][gt]
;	consensus.regexp.rc          	[AC][CT][AG]A[CT][ACG]GCAC[AG][AGT]A[AT][CGT]G[CT][CT]AAA[AC][CT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [IE] Inferred from experiment

 [GEA] Gene expression analysis

 [HIBSCS] Human inference based on similarity to consensus sequences

 [BPP] Binding of purified proteins

 [IHBCE] Inferred by a human based on computational evidence

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [IEP] Inferred from expression pattern

 [SM] Site mutation



Reference(s)    

 [1] Ariza RR., Li Z., Ringstad N., Demple B., 1995, Activation of multiple antibiotic resistance and binding of stress-inducible promoters by Escherichia coli Rob protein., J Bacteriol 177(7):1655-61

 [2] Skarstad K., Thony B., Hwang DS., Kornberg A., 1993, A novel binding protein of the origin of the Escherichia coli chromosome., J Biol Chem 268(8):5365-70

 [3] Martin RG., Rosner JL., 2002, Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data., Mol Microbiol 44(6):1611-24

 [4] Rosenberg EY., Bertenthal D., Nilles ML., Bertrand KP., Nikaido H., 2003, Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein., Mol Microbiol 48(6):1609-19

 [5] Hobbs EC., Yin X., Paul BJ., Astarita JL., Storz G., 2012, Conserved small protein associates with the multidrug efflux pump AcrB and differentially affects antibiotic resistance., Proc Natl Acad Sci U S A 109(41):16696-701

 [6] Bennik MH., Pomposiello PJ., Thorne DF., Demple B., 2000, Defining a rob regulon in Escherichia coli by using transposon mutagenesis., J Bacteriol 182(13):3794-801

 [7] Jair KW., Yu X., Skarstad K., Thony B., Fujita N., Ishihama A., Wolf RE., 1996, Transcriptional activation of promoters of the superoxide and multiple antibiotic resistance regulons by Rob, a binding protein of the Escherichia coli origin of chromosomal replication., J Bacteriol 178(9):2507-13

 [8] Taliaferro LP., Keen EF., Sanchez-Alberola N., Wolf RE., 2012, Transcription Activation by Escherichia coli Rob at Class II Promoters: Protein-Protein Interactions between Rob's N-Terminal Domain and the σ(70) Subunit of RNA Polymerase., J Mol Biol 419(3-4):139-57

 [9] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [10] Martin RG., Rosner JL., 1997, Fis, an accessorial factor for transcriptional activation of the mar (multiple antibiotic resistance) promoter of Escherichia coli in the presence of the activator MarA, SoxS, or Rob., J Bacteriol 179(23):7410-9

 [11] Kwon HJ., Bennik MH., Demple B., Ellenberger T., 2000, Crystal structure of the Escherichia coli Rob transcription factor in complex with DNA., Nat Struct Biol 7(5):424-30

 [12] Schneiders T., Levy SB., 2006, MarA mediated transcriptional repression of the rob promoter., J Biol Chem 281(15):10049-51

 [13] Aono R., Tsukagoshi N., Yamamoto M., 1998, Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12., J Bacteriol 180(4):938-44

 [14] Rodionov DA., Gelfand MS., Mironov AA., Rakhmaninova AB., 2001, Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria., J Mol Microbiol Biotechnol 3(2):319-24

 [15] Zhang A., Rosner JL., Martin RG., 2008, Transcriptional activation by MarA, SoxS and Rob of two tolC promoters using one binding site: a complex promoter configuration for tolC in Escherichia coli., Mol Microbiol 69(6):1450-5

 [16] Cohen SP., Hachler H., Levy SB., 1993, Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli., J Bacteriol 175(5):1484-92

 [17] Barbosa TM, Levy SB, 2000, Differential expression of over 60 chromosomal genes in Escherichia coli by constitutive expression of MarA., J Bacteriol, 2000 Jun

 [18] Martin RG, Rosner JL, 2003, Analysis of microarray data for the marA, soxS, and rob regulons of Escherichia coli., Methods Enzymol, 2003

 [19] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [20] Martin RG., Jair KW., Wolf RE., Rosner JL., 1996, Autoactivation of the marRAB multiple antibiotic resistance operon by the MarA transcriptional activator in Escherichia coli., J Bacteriol 178(8):2216-23

 [21] Griffith KL, Becker SM, Wolf RE Jr, 2005, Characterization of TetD as a transcriptional activator of a subset of genes of the Escherichia coli SoxS/MarA/Rob regulon., Mol Microbiol, 2005 May

 [22] Nunoshiba T., Hidalgo E., Amabile Cuevas CF., Demple B., 1992, Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene., J Bacteriol 174(19):6054-60

 [23] Wu J, Weiss B, 1992, Two-stage induction of the soxRS (superoxide response) regulon of Escherichia coli., J Bacteriol, 1992 Jun

 [24] White DG, Goldman JD, Demple B, Levy SB, 1997, Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli., J Bacteriol, 1997 Oct

 [25] Aono R, 1998, Improvement of organic solvent tolerance level of Escherichia coli by overexpression of stress-responsive genes., Extremophiles, 1998 Aug

 [26] Nakajima H, Kobayashi K, Kobayashi M, Asako H, Aono R, 1995, Overexpression of the robA gene increases organic solvent tolerance and multiple antibiotic and heavy metal ion resistance in Escherichia coli., Appl Environ Microbiol, 1995 Jun

 [27] Rosner JL, Dangi B, Gronenborn AM, Martin RG, 2002, Posttranscriptional activation of the transcriptional activator Rob by dipyridyl in Escherichia coli., J Bacteriol, 2002 Mar

 [28] Demple B, 1996, Redox signaling and gene control in the Escherichia coli soxRS oxidative stress regulon--a review., Gene, 1996 Nov 7

 [29] Chubiz LM, Glekas GD, Rao CV, 2012, Transcriptional cross talk within the mar-sox-rob regulon in Escherichia coli is limited to the rob and marRAB operons., J Bacteriol, 2012 Sep

 [30] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [31] Wood TI., Griffith KL., Fawcett WP., Jair KW., Schneider TD., Wolf RE., 1999, Interdependence of the position and orientation of SoxS binding sites in the transcriptional activation of the class I subset of Escherichia coli superoxide-inducible promoters., Mol Microbiol 34(3):414-30

 [32] Dangi B., Pelupessey P., Martin RG., Rosner JL., Louis JM., Gronenborn AM., 2001, Structure and dynamics of MarA-DNA complexes: an NMR investigation., J Mol Biol 314(1):113-27

 [33] Griffith KL., Wolf RE., 2001, Systematic mutagenesis of the DNA binding sites for SoxS in the Escherichia coli zwf and fpr promoters: identifying nucleotides required for DNA binding and transcription activation., Mol Microbiol 40(5):1141-54

 [34] Griffith KL, Shah IM, Myers TE, O'Neill MC, Wolf RE Jr, 2002, Evidence for "pre-recruitment" as a new mechanism of transcription activation in Escherichia coli: the large excess of SoxS binding sites per cell relative to the number of SoxS molecules per cell., Biochem Biophys Res Commun, 2002 Mar 8

 [35] Martin RG, Gillette WK, Martin NI, Rosner JL, 2002, Complex formation between activator and RNA polymerase as the basis for transcriptional activation by MarA and SoxS in Escherichia coli., Mol Microbiol, 2002 Jan

 [36] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [37] Griffith KL, Wolf RE Jr, 2002, A comprehensive alanine scanning mutagenesis of the Escherichia coli transcriptional activator SoxS: identifying amino acids important for DNA binding and transcription activation., J Mol Biol, 2002 Sep 13

 [38] Rhee S, Martin RG, Rosner JL, Davies DR, 1998, A novel DNA-binding motif in MarA: the first structure for an AraC family transcriptional activator., Proc Natl Acad Sci U S A, 1998 Sep 1

 [39] Rodgers ME, Schleif R, 2009, Solution structure of the DNA binding domain of AraC protein., Proteins, 2009 Oct

 [40] Griffith KL, Fitzpatrick MM, Keen EF 3rd, Wolf RE Jr, 2009, Two functions of the C-terminal domain of Escherichia coli Rob: mediating "sequestration-dispersal" as a novel off-on switch for regulating Rob's activity as a transcription activator and preventing degradation of Rob by Lon protease., J Mol Biol, 2009 May 8

 [41] Ali Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A, 1999, Growth phase-dependent variation in protein composition of the Escherichia coli nucleoid., J Bacteriol, 1999 Oct

 [42] Kakeda M, Ueguchi C, Yamada H, Mizuno T, 1995, An Escherichia coli curved DNA-binding protein whose expression is affected by the stationary phase-specific sigma factor sigma S., Mol Gen Genet, 1995 Sep 20

 [43] Alekshun MN, Levy SB, 1999, The mar regulon: multiple resistance to antibiotics and other toxic chemicals., Trends Microbiol, 1999 Oct

 [44] Randall LP, Woodward MJ, 2002, The multiple antibiotic resistance (mar) locus and its significance., Res Vet Sci, 2002 Apr



RegulonDB