RegulonDB RegulonDB 10.10:Regulon Page
   

TyrR DNA-binding transcriptional dual regulator

Synonyms: TyrR, TyrR-L-tyrosine, TyrR-L-phenylalanine, TyrR-L-tryptophan
Summary:
TyrR, "tyrosine repressor," is the dual transcriptional regulator of the TyrR regulon [28, 29, 30] The TyrR regulon involves genes that are essential for aromatic amino acid biosynthesis and transport. TyrR can act both as a repressor and as an activator of transcription at σ70-dependent promoters [26] TyrR is a homodimer in solution. In the presence of tyrosine and ATP it self-associates to form a hexamer [31, 32] TyrR consists of three functional domains, an N-terminal domain (aa 1-190), a central domain (aa 206-433), and a C-terminal domain (aa 444-513). The structure of the N-terminal domain has been solved [33] It contains both an ACT and a PAS domain and is responsible for the activation functions of TyrR. The central domain carries an AAA+ domain typical for enhancer-binding proteins [34] This domain is responsible for the binding and hydrolysis of ATP and for the ATP-dependent binding of the aromatic amino acid cofactors.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
TyrR Functional   Apo [BPP], [GEA], [SM] [1]
TyrR-L-phenylalanine Functional Allosteric Holo [BPP], [GEA], [SM] [1]
TyrR-L-tryptophan Functional Allosteric Holo [BPP], [GEA], [SM] [1]
TyrR-L-tyrosine Functional Allosteric Holo [BPP], [GEA], [SM] [1]
Evolutionary Family: EBP
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: tyrR
  Genome position: 1386720-1388261
  Length: 1542 bp / 513 aa
Operon name: ycjXF-tyrR
TU(s) encoding the TF:
Transcription unit        Promoter
tyrR
tyrRp
ycjXF-tyrR
ycjXp


Regulon       
Regulated gene(s) aroF, aroG, aroL, aroM, aroP, folA, mtr, tyrA, tyrB, tyrP, tyrR, yaiA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
phenylalanine (4)
tyrosine (4)
Porters (Uni-, Sym- and Antiporters) (3)
membrane (3)
chorismate (2)
Read more >
Regulated operon(s) aroF-tyrA, aroG, aroL-yaiA-aroM, aroP, folA, mtr, tyrB, tyrP, ycjXF-tyrR
First gene in the operon(s) aroF, aroG, aroL, aroP, folA, mtr, tyrB, tyrP, tyrR
Simple and complex regulons CpxR,TyrR
Cra,TyrR
HU,IHF,TrpR,TyrR
HU,IHF,TyrR
IHF,TyrR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[TyrR,-](8)
[TyrR,+](3)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  TyrR-L-tyrosine repressor aroFp Sigma70 -104.5 -155.5 aroF, tyrA
tcaaagggagTGTAAATTTATCTATACAgaggtaaggg
 2741297 2741314 [GEA], [APIORCISFBSCS], [SM] [2], [3], [4]
  TyrR-L-tyrosine repressor aroFp Sigma70 -52.5 -103.5 aroF, tyrA
aaattgcctgTGTAAATAAAAATGTACGaaatatggat
 2741245 2741262 [GEA], [APIORCISFBSCS], [SM] [2], [3], [4]
  TyrR-L-tyrosine repressor aroFp Sigma70 -29.5 -80.5 aroF, tyrA
gtacgaaataTGGATTGAAAACTTTACTttatgtgtta
 2741222 2741239 [GEA], [APIORCISFBSCS], [SM] [2], [3], [4], [5]
  TyrR-L-phenylalanine repressor aroGp Sigma70 -38.0 -80.0 aroG
tccgttcataGTGTAAAACCCCGTTTACacattctgac
 785544 785561 [APIORCISFBSCS], [BPP], [SM] [6]
  TyrR-L-tyrosine repressor aroLp1 Sigma70 -45.0 -170.0 aroL, yaiA, aroM
tggctaaatgTAATTTATTATTTACACTtcattcttga
 406226 406243 [GEA], [BPP], [SM] [1], [5], [7]
  TyrR-L-tyrosine repressor aroLp1 Sigma70 12.0 -114.0 aroL, yaiA, aroM
aggggtgtatTGAGATTTTCACTTTAAGtggaattttt
 406282 406299 [GEA], [BPP], [SM] [1], [5], [7]
  TyrR-L-tyrosine repressor aroLp1 Sigma70 31.0 -95.0 aroL, yaiA, aroM
cactttaagtGGAATTTTTTCTTTACAAtcgaaattgt
 406301 406318 [GEA], [BPP], [SM] [1], [5], [7]
  TyrR-L-tyrosine repressor aroPp1 Sigma70 40.5 -80.5 aroP
aacttctttgATGTAAACAAATTAATACaacaaacgga
 121623 121640 [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [10], [11], [12], [13]
  TyrR-L-tyrosine repressor aroPp1 Sigma70 63.5 -57.5 aroP
aatacaacaaACGGAATTGCAAACTTACacacgcatca
 121600 121617 [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [10], [11], [12], [13]
  TyrR-L-tyrosine repressor aroPp2 Sigma70 19.5 -80.5 aroP
aacttctttgATGTAAACAAATTAATACaacaaacgga
 121623 121640 [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [12], [13]
  TyrR-L-tyrosine repressor aroPp2 Sigma70 42.5 -57.5 aroP
aatacaacaaACGGAATTGCAAACTTACacacgcatca
 121600 121617 [GEA], [APIORCISFBSCS], [BPP], [SM] [8], [9], [10], [11], [12], [13]
  TyrR-L-tyrosine activator folAp Sigma70 -148.5 -172.5 folA
taaagagtgaCGTAAATCACACTTTACAgctaactgtt
 49642 49659 [GEA], [APIORCISFBSCS], [BPP], [SM] [14]
  TyrR-L-tyrosine activator folAp Sigma70 -106.0 -130.0 folA
tttgtttcatTGTAATGCGGCGAGTCCAgggagagagc
 49684 49701 [GEA], [APIORCISFBSCS], [BPP], [SM] [14]
  TyrR-L-tyrosine activator mtrp2 Sigma70 -106.5 -149.5 mtr
ggtggtgatgCGTAATCATCGCTGAACAgcgaacacaa
 3305958 3305975 [GEA], [APIORCISFBSCS], [BPP], [SM] [15], [16], [17]
  TyrR-L-tyrosine activator mtrp2 Sigma70 -76.5 -119.5 mtr
gaacacaatcTGTAAAATAATATATACAgccccgattt
 3305928 3305945 [GEA], [APIORCISFBSCS], [BPP], [SM] [15], [16], [17], [18]
  TyrR-L-tyrosine repressor tyrBp Sigma70 19.5 -13.5 tyrB
accacctgccCGTAAACCTGGAGAACCAtcgcgtgttt
 4267092 4267109 [GEA], [APIORCISFBSCS], [BPP], [SM] [19], [20]
  TyrR-L-tyrosine repressor tyrBp Sigma70 42.5 10.5 tyrB
aaccatcgcgTGTTTCAAAAAGTTGACGcctacgctgg
 4267115 4267132 [GEA], [APIORCISFBSCS], [BPP], [SM] [19], [20]
  TyrR repressor tyrPp1 Sigma70 -64.5 -100.5 tyrP
tgctttttatTGTACATTTATATTTACAccatatgtaa
 1989572 1989589 [GEA], [BCE], [BPP], [SM] [21], [22], [23], [24]
  TyrR-L-phenylalanine activator tyrPp1 Sigma70 -64.5 -100.5 tyrP
tgctttttatTGTACATTTATATTTACAccatatgtaa
 1989572 1989589 [GEA], [BCE], [BPP], [SM] [21], [22], [23], [24]
  TyrR-L-tyrosine repressor tyrPp1 Sigma70 -41.5 -77.5 tyrP
ttacaccataTGTAACGTCGGTTTGACGaagcagccgt
 1989595 1989612 [GEA], [BCE], [BPP], [SM] [21], [22], [23], [24]
  TyrR repressor tyrRp Sigma70 -95.5 -123.5 tyrR
tatcgggtgcTGACCGGATATCTTTACGccgaagtgcc
 1386588 1386605 [GEA], [APIORCISFBSCS] [25], [26]
  TyrR repressor tyrRp Sigma70 -51.5 -79.5 tyrR
tccgtctttgTGTCAATGATTGTTGACAgaaaccttcc
 1386632 1386649 [GEA], [APIORCISFBSCS] [25], [27]


Alignment and PSSM for TyrR TFBSs    

Aligned TFBS of TyrR   
  Sequence
  TGTATAGATAAATTTACACTC
  TGTACATTTATATTTACACCA
  TGTAAAACCCCGTTTACACAT
  TGTAATTTATTATTTACACTT
  TGTATATATTATTTTACAGAT
  CGTAAATCACACTTTACAGCT
  TGTATTAATTTGTTTACATCA
  CGTACATTTTTATTTACACAG
  TGTAAAGAAAAAATTCCACTT
  TGTTCAGCGATGATTACGCAT
  TGTCAATGATTGTTGACAGAA
  TGTTTCAAAAAGTTGACGCCT
  TGGATTGAAAACTTTACTTTA
  CGGAATTGCAAACTTACACAC
  TGACCGGATATCTTTACGCCG
  CGTCAAACCGACGTTACATAT
  TGGTTCTCCAGGTTTACGGGC
  TGTATTGAGATTTTCACTTTA
  TGTAATGCGGCGAGTCCAGGG

Position weight matrix (PWM). TyrR matrix-quality result    
A	0	0	1	13	8	10	4	8	6	10	8	6	3	0	0	17	0	13	0	7	5
C	4	0	0	3	4	2	0	6	4	2	2	4	1	0	1	2	19	0	10	5	3
G	0	19	3	0	0	1	7	2	3	2	1	7	1	1	2	0	0	4	5	2	3
T	15	0	15	3	7	6	8	3	6	5	8	2	14	18	16	0	0	2	4	5	8

Consensus    
;	consensus.strict             	tGtaaagcaaagtTTACacct
;	consensus.strict.rc          	AGGTGTAAACTTTGCTTTACA
;	consensus.IUPAC              	yGtahwkmhawvtTTACrsmt
;	consensus.IUPAC.rc           	AKSYGTAAABWTDKMWDTACR
;	consensus.regexp             	[ct]Gta[act][at][gt][ac][act]a[at][acg]tTTAC[ag][cg][ac]t
;	consensus.regexp.rc          	A[GT][CG][CT]GTAAA[CGT][AT]T[AGT][GT][AC][AT][AGT]TAC[AG]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [SM] Site mutation

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BCE] Binding of cellular extracts


Reference(s)    

 [1] Lawley B., Pittard AJ., 1994, Regulation of aroL expression by TyrR protein and Trp repressor in Escherichia coli K-12., J Bacteriol 176(22):6921-30

 [2] Cobbett CS., 1988, Repression of the aroF promoter by the TyrR repressor in Escherichia coli K-12: role of the 'upstream' operator site., Mol Microbiol 2(3):377-83

 [3] Cobbett CS., Delbridge ML., 1987, Regulatory mutants of the aroF-tyrA operon of Escherichia coli K-12., J Bacteriol 169(6):2500-6

 [4] Garner CC., Herrmann KM., 1985, Operator mutations of the Escherichia coli aroF gene., J Biol Chem 260(6):3820-5

 [5] DeFeyter RC., Davidson BE., Pittard J., 1986, Nucleotide sequence of the transcription unit containing the aroL and aroM genes from Escherichia coli K-12., J Bacteriol 165(1):233-9

 [6] Baseggio N., Davies WD., Davidson BE., 1990, Identification of the promoter, operator, and 5' and 3' ends of the mRNA of the Escherichia coli K-12 gene aroG., J Bacteriol 172(5):2547-57

 [7] Heatwole VM., Somerville RL., 1992, Synergism between the Trp repressor and Tyr repressor in repression of the aroL promoter of Escherichia coli K-12., J Bacteriol 174(1):331-5

 [8] Chye ML., Pittard J., 1987, Transcription control of the aroP gene in Escherichia coli K-12: analysis of operator mutants., J Bacteriol 169(1):386-93

 [9] Wang JG., Fan CS., Wu YQ., Jin RL., Liu DX., Shang L., Jiang PH., 2003, Regulation of aroP expression by tyrR gene in Escherichia coli., Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai) 35(11):993-7

 [10] Wang P., Yang J., Ishihama A., Pittard AJ., 1998, Demonstration that the TyrR protein and RNA polymerase complex formed at the divergent P3 promoter inhibits binding of RNA polymerase to the major promoter, P1, of the aroP gene of Escherichia coli., J Bacteriol 180(20):5466-72

 [11] Wang P., Yang J., Lawley B., Pittard AJ., 1997, Repression of the aroP gene of Escherichia coli involves activation of a divergent promoter., J Bacteriol 179(13):4213-8

 [12] Wang P., Yang J., Pittard AJ., 1997, Promoters and transcripts associated with the aroP gene of Escherichia coli., J Bacteriol 179(13):4206-12

 [13] Yang J., Wang P., Pittard AJ., 1999, Mechanism of repression of the aroP P2 promoter by the TyrR protein of Escherichia coli., J Bacteriol 181(20):6411-8

 [14] Yang J., Ogawa Y., Camakaris H., Shimada T., Ishihama A., Pittard AJ., 2007, folA, a New Member of the TyrR Regulon in Escherichia coli K-12., J Bacteriol 189(16):6080-4

 [15] Heatwole VM., Somerville RL., 1991, The tryptophan-specific permease gene, mtr, is differentially regulated by the tryptophan and tyrosine repressors in Escherichia coli K-12., J Bacteriol 173(11):3601-4

 [16] Sarsero JP., Pittard AJ., 1991, Molecular analysis of the TyrR protein-mediated activation of mtr gene expression in Escherichia coli K-12., J Bacteriol 173(23):7701-4

 [17] Yang J., Murakami K., Camakaris H., Fujita N., Ishihama A., Pittard AJ., 1997, Amino acid residues in the alpha-subunit C-terminal domain of Escherichia coli RNA polymerase involved in activation of transcription from the mtr promoter., J Bacteriol 179(19):6187-91

 [18] Sarsero JP., Wookey PJ., Pittard AJ., 1991, Regulation of expression of the Escherichia coli K-12 mtr gene by TyrR protein and Trp repressor., J Bacteriol 173(13):4133-43

 [19] Yang J., Camakaris H., Pittard J., 2002, Molecular analysis of tyrosine-and phenylalanine-mediated repression of the tyrB promoter by the TyrR protein of Escherichia coli., Mol Microbiol 45(5):1407-19

 [20] Yang J., Pittard J., 1987, Molecular analysis of the regulatory region of the Escherichia coli K-12 tyrB gene., J Bacteriol 169(10):4710-5

 [21] Hwang JS., Yang J., Pittard AJ., 1999, Specific contacts between residues in the DNA-binding domain of the TyrR protein and bases in the operator of the tyrP gene of Escherichia coli., J Bacteriol 181(8):2338-45

 [22] Kasian PA., Davidson BE., Pittard J., 1986, Molecular analysis of the promoter operator region of the Escherichia coli K-12 tyrP gene., J Bacteriol 167(2):556-61

 [23] Lawley B., Fujita N., Ishihama A., Pittard AJ., 1995, The TyrR protein of Escherichia coli is a class I transcription activator., J Bacteriol 177(1):238-41

 [24] Yang J., Hwang JS., Camakaris H., Irawaty W., Ishihama A., Pittard J., 2004, Mode of action of the TyrR protein: repression and activation of the tyrP promoter of Escherichia coli., Mol Microbiol 52(1):243-56

 [25] Camakaris H., Pittard J., 1982, Autoregulation of the tyrR gene., J Bacteriol 150(1):70-5

 [26] Pittard AJ., Davidson BE., 1991, TyrR protein of Escherichia coli and its role as repressor and activator., Mol Microbiol 5(7):1585-92

 [27] Cornish EC., Argyropoulos VP., Pittard J., Davidson BE., 1986, Structure of the Escherichia coli K12 regulatory gene tyrR. Nucleotide sequence and sites of initiation of transcription and translation., J Biol Chem 261(1):403-10

 [28] Wallace BJ., Pittard J., 1969, Regulator gene controlling enzymes concerned in tyrosine biosynthesis in Escherichia coli., J Bacteriol 97(3):1234-41

 [29] Brown KD, Somerville RL, 1971, Repression of aromatic amino acid biosynthesis in Escherichia coli K-12., J Bacteriol, 108(1):386 10.1128/jb.108.1.386-399.1971

 [30] Pittard J, Camakaris H, Yang J, 2005, The TyrR regulon., Mol Microbiol, 55(1):16 10.1111/j.1365-2958.2004.04385.x

 [31] Wilson TJ, Maroudas P, Howlett GJ, Davidson BE, 1994, Ligand-induced self-association of the Escherichia coli regulatory protein TyrR., J Mol Biol, 238(3):309 10.1006/jmbi.1994.1294

 [32] Dixon MP, Pau RN, Howlett GJ, Dunstan DE, Sawyer WH, Davidson BE, 2002, The central domain of Escherichia coli TyrR is responsible for hexamerization associated with tyrosine-mediated repression of gene expression., J Biol Chem, 277(26):23186 10.1074/jbc.M112184200

 [33] Verger D, Carr PD, Kwok T, Ollis DL, 2007, Crystal structure of the N-terminal domain of the TyrR transcription factor responsible for gene regulation of aromatic amino acid biosynthesis and transport in Escherichia coli K12., J Mol Biol, 367(1):102 10.1016/j.jmb.2006.12.018

 [34] Swarbrick JD, Bashtannyk T, Dixon M, Pau RN, Davidson BE, Gooley PR, 2002, Backbone resonance assignment of the 2H, 13C, 15N labelled 32kDa central domain of Escherichia coli TyrR., J Biomol NMR, 22(4):381 10.1023/a:1014928626150

 [35] Zhao S, Zhu Q, Somerville RL, 2000, The sigma(70) transcription factor TyrR has zinc-stimulated phosphatase activity that is inhibited by ATP and tyrosine., J Bacteriol, 182(4):1053 10.1128/JB.182.4.1053-1061.2000

 [36] Yang J., Ganesan S., Sarsero J., Pittard AJ., 1993, A genetic analysis of various functions of the TyrR protein of Escherichia coli., J Bacteriol 175(6):1767-76

 [37] Wang Y, Zhao S, Somerville RL, Jardetzky O, 2001, Solution structure of the DNA-binding domain of the TyrR protein of Haemophilus influenzae., Protein Sci, 10(3):592 10.1110/ps.45301

 [38] Choi U., Park YH., Kim YR., Seok YJ., Lee CR., 2016, Increased expression of genes involved in uptake and degradation of murein tripeptide under nitrogen starvation in Escherichia coli., FEMS Microbiol Lett 363(14)

 [39] Whipp MJ, Pittard AJ, 1977, Regulation of aromatic amino acid transport systems in Escherichia coli K-12., J Bacteriol, 132(2):453 10.1128/jb.132.2.453-461.1977

 [40] Davies WD, Pittard J, Davidson BE, 1985, Cloning of aroG, the gene coding for phospho-2-keto-3-deoxy-heptonate aldolase(phe), in Escherichia coli K-12, and subcloning of the aroG promoter and operator in a promoter-detecting plasmid., Gene, 33(3):323 10.1016/0378-1119(85)90240-9

 [41] Bai D, Ding D, Li J, Cong L, Zhang D, 2019, Pinpointing the L-phenylalanine binding sites of TyrR using biosensors and computer-aided simulation., Biotechnol Lett, 41(3):401 10.1007/s10529-019-02645-x


RegulonDB