RegulonDB RegulonDB 10.6.3:Regulon Page
   

CpxR DNA-binding transcriptional dual regulator

Synonyms: CpxR-Phosphorylated, CpxR
Summary:
The regulatory protein CpxR appears to control at least 100 operons [5] Some of these operons are involved in cellular functions, such as "conjugative plasmid gene expression" (cpx) [24, 25], the envelope stress response system, pilus assembly, secretion, motility and chemotaxis, adherence, biofilm development, multidrug resistance and efflux [26], and the copper-responsive regulatory system [1], among others. In pathogenic bacteria it controls genes involved in invasion of host cells [27]. Sometimes, CpxR acts to modulate the action of the main activators or repressors of some promoters [26]. CpxR is the response regulator in the two-component regulatory system comprised of CpxR and CpxA [28].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
CpxR Non-Functional   Apo [BPP] [1]
CpxR-Phosphorylated Functional Covalent Holo [BPP], [IPI] [1], [2], [3]
Evolutionary Family: OmpR
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: cpxR
  Genome position: 4104972-4105670
  Length: 699 bp / 232 aa
Operon name: cpxRA
TU(s) encoding the TF:
Transcription unit        Promoter
cpxRA
cpxRp


Regulon       
Regulated gene(s) acrD, aroG, bacA, baeR, baeS, bamE, cheA, cheW, cpxA, cpxP, cpxQ, cpxR, csgA, csgB, csgC, csgD, csgE, csgF, csgG, cyaR, degP, dgcZ, dsbA, dsbC, efeU, fabZ, ftnB, hha, kbp, ldtC, ldtD, lpxA, lpxD, marA, marB, marR, mdtA, mdtB, mdtC, mdtD, motA, motB, mscM, mzrA, ompC, ompF, ppiA, ppiD, psd, rpoE, rpoH, rprA, rseA, rseB, rseC, rseD, sbmA, skp, slt, spy, srkA, tomB, tsr, ung, yaiW,
Read more >
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (21)
Transcription related (13)
other (mechanical, nutritional, oxidative stress) (8)
chaperoning, repair (refolding) (7)
drug resistance/sensitivity (6)
Read more >
Regulated operon(s) acrD, aroG, bacA, bamA-skp-lpxD-fabZ-lpxAB-rnhB-dnaE, bamE, cpxPQ, cpxRA, csgBAC, csgDEFG, cyaR, degP, dgcZ, efeU, ftnB, ldtC, ldtD, marRAB, mdtABCD-baeSR, motAB-cheAW, ompC, ompF, ppiA, ppiD, psd-mscM, rpoH, rprA, rseD-rpoE-rseABC, sbmA-yaiW, slt, spy, srkA-dsbA, tomB-hha, tsr, ung, xerD-dsbC-recJ-prfB-lysS, yccA, yebE, yidQ, yqaE-kbp, yqjA-mzrA
First gene in the operon(s) acrD, aroG, bacA, cpxP, cpxR, csgB, csgD, cyaR, degP, dsbC, ftnB, skp, marR, mdtA, motA, ompC, ompF, ppiA, ppiD, rseD, rpoH, rprA, sbmA, bamE, spy, srkA, tsr, ung, yidQ, yqaE, yqjA, psd, tomB, ldtD, yccA, efeU, ldtC, dgcZ, yebE, yqaE, slt
Simple and complex regulons AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS
BaeR,CpxR
BasR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsB,RstA,ppGpp
BasR,CpxR,PdhR
CRP,CpxR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[CpxR,+](29)
[CpxR,-](11)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  CpxR-Phosphorylated activator acrDp2 Sigma54 -127.5 -172.0 acrD
ggagggtgagGAAAGTCAGTTAATGTAATgcctcctact
2587414 2587432 [BPP], [GEA], [IC] [4]
  CpxR-Phosphorylated activator acrDp2 Sigma54 -98.0 -142.5 acrD
tcctactgacCAAAGAATACTTGCacttaaggtt
2587446 2587459 [BPP], [IC] [4]
  CpxR-Phosphorylated activator acrDp2 Sigma54 -66.0 -110.5 acrD
ggttcagtatAAAAGGGCATGATAATTTacattaactc
2587476 2587493 [BPP], [GEA], [IC] [4]
  CpxR-Phosphorylated activator aroGp Sigma70 -38.0 -80.0 aroG
cgttcatagtGTAAAACCCCGTTTAcacattctga
785546 785560 [BPP], [HIBSCS] [1]
  CpxR-Phosphorylated activator bacAp Sigma24 -292.0 -336.0 bacA
tgggataaccGTAAAGCGGCGAAAAgtgatgatgt
3204460 3204474 [ICA] [5]
  CpxR-Phosphorylated repressor bamEp Sigma24 11.0 -109.0 bamE
agagtaaacaGCAAAACGCCGTAAGaccggaaagc
2753489 2753503 [ICA] [5]
  CpxR-Phosphorylated activator cpxPp Sigma70 -52.0 -87.0 cpxP, cpxQ
aatccatgacTTTACGTTGTTTTACaccccctgac
4105726 4105740 [BPP], [GEA], [HIBSCS] [1], [2], [6], [7]
  CpxR-Phosphorylated activator cpxPp Sigma70 -32.0 -67.0 cpxP, cpxQ
tttacaccccCTGACGCATGTTTGCagcctgaatc
4105746 4105760 [GEA], [HIBSCS] [6], [7]
  CpxR-Phosphorylated activator cpxPp Sigma70 -5.0 -39.5 cpxP, cpxQ
agcctgaatcGTAAACTCTCTATCGTTGAAtcgcgacaga
4105771 4105790 [BPP], [GEA], [HIBSCS] [1], [6], [7]
  CpxR-Phosphorylated activator cpxRp Sigma38, Sigma70 -67.0 -83.0 cpxR, cpxA
gattcaggctGCAAACATGCGTCAGggggtgtaaa
4105746 4105760 [GEA], [HIBSCS] [6], [7]
  CpxR-Phosphorylated activator cpxRp Sigma38, Sigma70 -47.0 -63.0 cpxR, cpxA
gtcagggggtGTAAAACAACGTAAAgtcatggatt
4105726 4105740 [BPP], [GEA], [HIBSCS] [1], [2], [6], [7]
  CpxR-Phosphorylated repressor csgBp Sigma38, Sigma70, Sigma38 -464.0 -556.0 csgB, csgA, csgC
gtgttaaacaTGTAACTAAATGTAActcgttatat
1103388 1103402 [BPP], [GEA], [HIBSCS] [8]
  CpxR-Phosphorylated repressor csgBp Sigma38, Sigma70, Sigma38 -255.0 -347.0 csgB, csgA, csgC
cacacctccgTGGACAATTTTTTACtgcaaaaaga
1103597 1103611 [HIBSCS] [5]
  CpxR-Phosphorylated repressor csgBp Sigma38, Sigma70, Sigma38 8.0 -85.0 csgB, csgA, csgC
actttccatcGTAACGCAGCGTTAAcaaaatacag
1103859 1103873 [AIBSCS], [BPP], [GEA], [HIBSCS] [5], [8]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -186.0 -334.0 csgD, csgE, csgF, csgG
accgaaatatTTTTTATATGCATTAttagtaagtt
1103523 1103537 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -178.0 -326.5 csgD, csgE, csgF, csgG
attttttataTGCATTATTAGTAAgttatcacca
1103516 1103529 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -166.0 -314.0 csgD, csgE, csgF, csgG
cattattagtAAGTTATCACCATTTgtatgatttt
1103503 1103517 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -141.0 -289.0 csgD, csgE, csgF, csgG
gtatgattttTTAAAATTGTGCAATaaaaaccaaa
1103478 1103492 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -129.5 -278.0 csgD, csgE, csgF, csgG
ttaaaattgtGCAATAAAAACCAAATGtacaactttt
1103466 1103482 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -108.5 -257.0 csgD, csgE, csgF, csgG
aaatgtacaaCTTTTCTATCATTTCtaaacttaat
1103446 1103460 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -100.0 -248.0 csgD, csgE, csgF, csgG
acttttctatCATTTCTAAACTTAAtaaaacctta
1103437 1103451 [BPP], [GEA], [HIBSCS] [9], [10]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -95.5 -244.0 csgD, csgE, csgF, csgG
ttctatcattTCTAAACTTAATAAAaccttaaggt
1103433 1103447 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -73.5 -222.0 csgD, csgE, csgF, csgG
aaaaccttaaGGTTAACATTTTAATataacgagtt
1103411 1103425 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -52.0 -200.0 csgD, csgE, csgF, csgG
aatataacgaGTTACATTTAGTTACatgtttaaca
1103389 1103403 [BPP], [GEA], [HIBSCS] [8], [10]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -48.0 -196.0 csgD, csgE, csgF, csgG
taacgagttaCATTTAGTTACATGTttaacacttg
1103385 1103399 [BPP], [GEA], [HIBSCS] [10]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -43.0 -191.0 csgD, csgE, csgF, csgG
agttacatttAGTTACATGTTTAACacttgattta
1103380 1103394 [BPP], [GEA], [HIBSCS] [9]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 -21.5 -170.0 csgD, csgE, csgF, csgG
taacacttgaTTTAAGATTTGTAATggctagattg
1103359 1103373 [BPP], [GEA], [HIBSCS] [9], [10]
  CpxR-Phosphorylated repressor csgDp1 Sigma38, Sigma70 3.0 -146.0 csgD, csgE, csgF, csgG
tggctagattGAAATCAGATGTAATccattagttt
1103335 1103349 [BPP], [GEA], [HIBSCS] [10]
  CpxR-Phosphorylated repressor cyaRp Sigma24, Sigma70, Sigma38 nd nd cyaR nd nd [BPP], [GEA] [11]
  CpxR-Phosphorylated activator degPp Sigma24 -223.0 -262.0 degP
gaggctgtcaGTAAATTACCGTCAGattctcctga
180615 180629 [BPP], [GEA] [2], [12]
  CpxR-Phosphorylated activator degPp Sigma24 -71.5 -110.0 degP
ccaggcttttGTAAAGACGAACAATAAATttttaccttt
180765 180783 [AIBSCS], [BPP], [GEA], [HIBSCS] [1], [2], [12]
  CpxR-Phosphorylated activator degPp Sigma24 -63.0 -102.0 degP
gtaaagacgaACAATAAATTTTTACcttttgcaga
180775 180789 [BPP], [GEA], [HIBSCS] [2], [12]
  CpxR-Phosphorylated activator dgcZp Sigma70 -41.0 -70.5 dgcZ
aacttcggatTTCTATGAAAATATTGACgtaattttgc
1623912 1623929 [BPP], [GEA], [HIBSCS] [1], [7]
  CpxR-Phosphorylated activator dsbCp Sigma24 -391.5 -404.0 dsbC
acgggtcattGGTAAAGGCAACAAAgagcgtctgg
3039219 3039233 [GEA], [HIBSCS] [13]
  CpxR-Phosphorylated activator dsbCp Sigma24 -357.5 -369.0 dsbC
tgccgttaggTGAAGAGGCGGTTTActggctggaa
3039184 3039198 [GEA], [HIBSCS] [13]
  CpxR-Phosphorylated repressor efeU_1p Sigma70 -54.5 -103.0 efeU
ccaacatcatTTTATAAACATTCCGcttgtgtttt
1081246 1081260 [BPP], [GEA], [HIBSCS] [1], [7]
  CpxR-Phosphorylated activator ftnBp2 Sigma70 -61.0 -187.0 ftnB
tcaatgaaatGTAAAAATATATAAActtgatgatt
1986731 1986745 [BPP], [HIBSCS] [1]
  CpxR-Phosphorylated activator hlpAp Sigma24 -101.0 -128.0 skp, lpxD, fabZ, lpxA
tttaacatcgGTAAAACCTGGTAAGtgttctccac
200347 200361 [GEA], [HIBSCS] [13]
  CpxR-Phosphorylated activator ldtDp nd -192.0 -307.5 ldtD
gatttgcgccGCAACTCCCTGAAACGcttccaggaa
980732 980747 [BPP], [GEA], [HIBSCS] [7], [14]
  CpxR-Phosphorylated activator marRp Sigma70 -29.0 -55.5 marR, marA, marB
attcattcatTTGACTTATACTTGCCtgggcaatat
1619057 1619072 [BPP], [GEA], [HIBSCS] [15]
  CpxR-Phosphorylated activator mdtAp Sigma38 -128.5 -165.0 mdtA, mdtB, mdtC, mdtD, baeS, baeR
cagtctatcgCTAACGCGTAGATAAAAtagtttcctg
2153843 2153859 [BPP], [GEA], [IC] [4]
  CpxR-Phosphorylated activator mdtAp Sigma38 -66.5 -103.0 mdtA, mdtB, mdtC, mdtD, baeS, baeR
atgtgcccgtCATTCAGACGATTCCagacagtgtt
2153906 2153920 [BPP], [GEA], [IC] [4]
  CpxR-Phosphorylated repressor motAp Sigma28 -37.0 -200.0 motA, motB, cheA, cheW
atcccgggcaGTAAAAAGACGTAAActttcccaga
1977332 1977346 [BPP], [GEA] [5], [6]
  CpxR-Phosphorylated activator ompCp1 Sigma70 -351.0 -432.0 ompC
tgaaaagtgtGTAAAGAAGGGTAAAaaaaaccgaa
2313174 2313188 [AIBSCS], [BPP], [GEA] [16]
  CpxR-Phosphorylated activator ompCp1 Sigma70 -134.0 -215.0 ompC
atgttaggtgCTTATTTCGCCATTCcgcaataatc
2312957 2312971 [AIBSCS], [BPP], [GEA] [16]
  CpxR-Phosphorylated activator ompCp1 Sigma70 -95.0 -176.5 ompC
aagttcccttGCATTTACATTTtgaaacatct
2312920 2312931 [AIBSCS], [BPP], [GEA] [16]
  CpxR-Phosphorylated repressor ompFp Sigma38, Sigma70 -429.5 -540.0 ompF
ttttctgtcaAGTTATCTGTTTGTTAAgtcaagcaat
987514 987530 [AIBSCS], [BPP], [GEA] [7], [16]
  CpxR-Phosphorylated repressor ompFp Sigma38, Sigma70 -373.0 -483.0 ompF
cgatcatcctGTTACGGAATATTACattgcaacat
987458 987472 [AIBSCS], [BPP], [GEA] [7], [16]
  CpxR-Phosphorylated repressor ompFp Sigma38, Sigma70 -93.0 -203.0 ompF
ttccttaaatTTTACTTTTGGTTACatattttttc
987178 987192 [AIBSCS], [BPP], [GEA] [7], [16]
  CpxR-Phosphorylated repressor ompFp Sigma38, Sigma70 -68.5 -179.0 ompF
acatatttttTCTTTTTGAAACCAAATctttatcttt
987153 987169 [AIBSCS], [BPP], [GEA] [7], [16]
  CpxR-Phosphorylated activator ppiAp1 Sigma70 -47.0 -85.0 ppiA
tttcagatacGTAAAATTAGGTAAAgggatggcct
3492375 3492389 [BPP], [GEA], [HIBSCS] [1], [2], [17]
  CpxR-Phosphorylated activator ppiDp2 Sigma70 -165.0 -261.0 ppiD
ccgcagaccgGTAAAGAGATCACCAtcgctgctgc
461647 461661 [HIBSCS], [SM] [18]
  CpxR-Phosphorylated activator ppiDp2 Sigma70 -117.0 -213.0 ppiD
ttccgtgcagGTAAAGCACTGAAAGacgcggtaaa
461695 461709 [HIBSCS], [SM] [18]
  CpxR-Phosphorylated activator ppiDp2 Sigma70 -96.5 -192.0 ppiD
gaaagacgcgGTAAACTAAGCGTTGTCcccagtgggg
461715 461731 [HIBSCS], [SM] [18]
  CpxR-Phosphorylated repressor psdp Sigma24 151.0 -128.0 psd, mscM
catggcgcagGTAAAAACGCGTAAAaacttttctg
4390481 4390495 [ICA] [5]
  CpxR-Phosphorylated repressor rpoEp1a nd 67.0 44.0 rseD, rpoE, rseA, rseB, rseC
aaacagatgcGTTACGGAACTTTACaaaaacgaga
2710113 2710127 [AIBSCS], [GEA] [5]
  CpxR-Phosphorylated activator rpoHp1 Sigma70, Sigma38 nd nd rpoH nd nd [GEA] [19]
  CpxR-Phosphorylated activator rprAp nd nd nd rprA nd nd [BPP], [GEA] [11]
  CpxR-Phosphorylated activator sbmAp Sigma24 nd nd sbmA, yaiW nd nd [AIBSCS], [GEA] [7]
  CpxR-Phosphorylated activator sltp7 Sigma32 -52.0 -84.5 slt
aaaagtgtccGTAACGTGGCGTAAACggcaatgact
4630641 4630656 [AIBSCS], [BPP], [GEA], [HIBSCS], [IGI] [7], [14]
  CpxR-Phosphorylated activator spyp Sigma70 -50.0 -113.0 spy
gttttttacaCTTTCATTGTTTTACcgttgctctg
1825731 1825745 [BPP], [GEA], [HIBSCS] [1], [7], [20], [21]
  CpxR-Phosphorylated activator srkAp Sigma70 -49.0 -73.0 srkA, dsbA
taattaaagaGTAAAAGCTTGTAAGcggcgccacc
4042335 4042349 [BPP], [GEA], [HIBSCS] [1], [2], [22]
  CpxR-Phosphorylated activator tomBp1 Sigma70 -50.0 -136.0 tomB, hha
cttcctaattGTAATTTTTCGTAATaatgcgatga
480837 480851 [BPP], [HIBSCS] [1]
  CpxR-Phosphorylated repressor tsrp1 Sigma70 -9.0 -254.0 tsr
ttacgcgcgcGTAAAGTAAGGTAAAtaactgagtg
4591396 4591410 [BPP] [6]
  CpxR-Phosphorylated repressor ungp nd -81.0 -97.0 ung
attttaccaaTTTACATTTTTTTGCactcgtttaa
2716650 2716664 [BCE], [BPP] [23]
  CpxR-Phosphorylated activator yccAp Sigma70 -53.0 -78.0 yccA
gatcaaatgcGTAAAGATGGGTAAAacttctgggt
1031489 1031503 [BPP], [GEA], [HIBSCS] [1], [7]
  CpxR-Phosphorylated activator ycfSp Sigma70 -53.5 -97.0 ldtC
catctgcaacATTTACAAATTCTTTGCacttccctgc
1170463 1170479 [BPP], [HIBSCS] [1]
  CpxR-Phosphorylated activator yebEp Sigma70 -44.0 -69.0 yebE
ttgcgcatctTTTGTCTCGATATACattttctgac
1929769 1929783 [BPP], [GEA], [HIBSCS] [1], [7]
  CpxR-Phosphorylated activator yidQp Sigma24 -254.0 -437.5 yidQ
tagcaatgcgGTAATGGTTTTCGTCTACcagttcaacg
3867282 3867299 [GEA], [HIBSCS] [13]
  CpxR-Phosphorylated activator yidQp Sigma24 -176.0 -359.5 yidQ
tttctaagtgGTTAAACAAACGGTCAAAtccaatagca
3867360 3867377 [GEA], [HIBSCS] [13]
  CpxR-Phosphorylated activator yidQp Sigma24 -143.5 -327.0 yidQ
tagcagaacgGTAAAGCGGGGATAAATcaaagttacg
3867393 3867409 [GEA], [HIBSCS] [13]
  CpxR-Phosphorylated activator yqaEp nd -48.0 -105.5 yqaE, kbp
gcctcagcagCGTAAATGAGAGTAAAagcgtaagct
2797126 2797141 [AIBSCS], [BPP], [GEA], [HIBSCS] [7], [11], [14]
  CpxR-Phosphorylated activator yqjAp1 Sigma70 -47.0 -272.0 yqjA, mzrA
agtataaagtGTCAGCCTGTGTAAAtcctctcgcc
3247494 3247508 [BPP], [HIBSCS] [1]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  CpxR-Phosphorylated activator nd nd nd nd nd nd [GEA], [HIBSCS] [7]


Alignment and PSSM for CpxR TFBSs    

Aligned TFBS of CpxR   
  Sequence
  TTTACGTTGTTTTACACCCC
  TTTACGTCTTTTTACTGCCC
  TTTACCCATCTTTACGCATT
  TTTTCGCCGCTTTACGGTTA
  TTTACCCTTCTTTACACACT
  CTTTCATTGTTTTACCGTTG
  TTTACATTTTTTTGCACTCG
  CTTACCAGGTTTTACCGATG
  TTTACGCCACGTTACGGACA
  TTTACCTTACTTTACGCGCG
  TTTACCTAATTTTACGTATC
  TTTACGCGTTTTTACCTGCG
  CTTACGGCGTTTTGCTGTTT
  TTATCCCCGCTTTACCGTTC
  TTTACTTTTGGTTACATATT
  CTTACAAGCTTTTACTCTTT
  TTTATATATTTTTACATTTC
  CTTTCAGTGCTTTACCTGCA
  TTAACGCTGCGTTACGATGG
  TTTACACAGGCTGACACTTT
  CTGACGGTAATTTACTGACA
  CTGACGCATGTTTGCAGCCT
  TTTACTCTCATTTACGCTGC
  GTTACGGAACTTTACAAAAA
  TGGACAATTTTTTACTGCAA
  TAAACGGGGTTTTACACTAT
  ATTACGAAAAATTACAATTA
  TTTACAAATTCTTTGCACTT
  TTATCTACGCGTTAGCGATA
  GTTACGGAATATTACATTGC
  ATTACATCTGATTTCAATCT
  CTTTGTTGCCTTTACCAATG
  TGTACATTTGGTTTTTATTG
  TGGTGATCTCTTTACCGGTC
  TTTTATTAAGTTTAGAAATG
  TTTTCTTTTTGAAACCAAAT
  TTGACCGTTTGTTTAACCAC
  ATTACATTAACTGACTTTCC
  TTGACTTATACTTGCCTGGG
  TTTAAGATTTGTAATGGCTA
  TTTTATAAACATTCCGCTTG
  GTTTCAGGGAGTTGCGGCGC
  TGTAAATTATCATGCCCTTT
  CTTTTGTCTCGATATACATT
  CGATAGAGAGTTTACGATTC
  CTTTTCTATCATTTCTAAAC
  TTATCTGTTTGTTAAGTCAA
  CTTATTTCGCCATTCCGCAA
  ATTGTTCGTCTTTACAAAAG
  TAAACTAAGCGTTGTCCCCA
  CTGACCAAAGAATACTTGCA
  AGTTACATGTTTAACACTTG
  ATTACGTCAATATTTTCATA
  CATACAAATGGTGATAACTT
  TATTAAAATGTTAACCTTAA
  TATATGCATTATTAGTAAGT
  CGGTAATGGTTTTCGTCTAC
  CTTGCATTTACATTTTGAAA
  CTGGAATCGTCTGAATGACG
  TAAACCGCCTCTTCACCTAA

Position weight matrix (PWM). CpxR matrix-quality result   
A	6	6	8	39	9	19	14	18	14	8	7	7	4	42	4	18	14	19	13	17
C	17	0	0	0	43	11	12	13	4	18	9	0	0	3	44	16	18	12	15	14
G	3	7	9	3	2	18	10	9	17	10	13	0	4	7	5	12	17	6	6	14
T	34	47	43	18	6	12	24	20	25	24	31	53	52	8	7	14	11	23	26	15

Consensus   
;	consensus.strict             	tttaCgtttctTTaCccttg
;	consensus.strict.rc          	CAAGGGTAAAGAAACGTAAA
;	consensus.IUPAC              	yttwCrthkykTTaCmswys
;	consensus.IUPAC.rc           	SRWSKGTAAMRMDAYGWAAR
;	consensus.regexp             	[ct]tt[at]C[ag]t[act][gt][ct][gt]TTaC[ac][cg][at][ct][cg]
;	consensus.regexp.rc          	[CG][AG][AT][CG][GT]GTAA[AC][AG][AC][AGT]A[CT]G[AT]AA[AG]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [IPI] Inferred from physical interaction

 [GEA] Gene expression analysis

 [IC] Inferred by curator

 [HIBSCS] Human inference based on similarity to consensus sequences

 [ICA] Inferred by computational analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [SM] Site mutation

 [IGI] Inferred from genetic interaction

 [BCE] Binding of cellular extracts



Reference(s)    

 [1] Yamamoto K., Ishihama A., 2006, Characterization of copper-inducible promoters regulated by CpxA/CpxR in Escherichia coli., Biosci Biotechnol Biochem 70(7):1688-95

 [2] Pogliano J., Lynch AS., Belin D., Lin EC., Beckwith J., 1997, Regulation of Escherichia coli cell envelope proteins involved in protein folding and degradation by the Cpx two-component system., Genes Dev 11(9):1169-82

 [3] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56

 [4] Hirakawa H., Inazumi Y., Masaki T., Hirata T., Yamaguchi A., 2005, Indole induces the expression of multidrug exporter genes in Escherichia coli., Mol Microbiol 55(4):1113-26

 [5] De Wulf P., McGuire AM., Liu X., Lin EC., 2002, Genome-wide profiling of promoter recognition by the two-component response regulator CpxR-P in Escherichia coli., J Biol Chem 277(29):26652-61

 [6] De Wulf P., Kwon O., Lin EC., 1999, The CpxRA signal transduction system of Escherichia coli: growth-related autoactivation and control of unanticipated target operons., J Bacteriol 181(21):6772-8

 [7] Raivio TL., Leblanc SK., Price NL., 2013, The Escherichia coli Cpx envelope stress response regulates genes of diverse function that impact antibiotic resistance and membrane integrity., J Bacteriol 195(12):2755-67

 [8] Prigent-Combaret C., Brombacher E., Vidal O., Ambert A., Lejeune P., Landini P., Dorel C., 2001, Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene., J Bacteriol 183(24):7213-23

 [9] Ogasawara H., Yamada K., Kori A., Yamamoto K., Ishihama A., 2010, Regulation of the Escherichia coli csgD promoter: interplay between five transcription factors., Microbiology 156(Pt 8):2470-83

 [10] Jubelin G., Vianney A., Beloin C., Ghigo JM., Lazzaroni JC., Lejeune P., Dorel C., 2005, CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli., J Bacteriol 187(6):2038-49

 [11] Vogt SL., Evans AD., Guest RL., Raivio TL., 2014, The Cpx envelope stress response regulates and is regulated by small noncoding RNAs., J Bacteriol 196(24):4229-38

 [12] Danese PN., Snyder WB., Cosma CL., Davis LJ., Silhavy TJ., 1995, The Cpx two-component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP., Genes Dev 9(4):387-98

 [13] Dartigalongue C., Missiakas D., Raina S., 2001, Characterization of the Escherichia coli sigma E regulon., J Biol Chem 276(24):20866-75

 [14] Bernal-Cabas M., Ayala JA., Raivio TL., 2015, The Cpx envelope stress response modifies peptidoglycan cross-linking via the L,D-transpeptidase LdtD and the novel protein YgaU., J Bacteriol 197(3):603-14

 [15] Weatherspoon-Griffin N., Yang D., Kong W., Hua Z., Shi Y., 2014, The CpxR/CpxA two-component regulatory system up-regulates the multidrug resistance cascade to facilitate Escherichia coli resistance to a model antimicrobial peptide., J Biol Chem 289(47):32571-82

 [16] Batchelor E., Walthers D., Kenney LJ., Goulian M., 2005, The Escherichia coli CpxA-CpxR envelope stress response system regulates expression of the porins ompF and ompC., J Bacteriol 187(16):5723-31

 [17] Oshima T., Aiba H., Masuda Y., Kanaya S., Sugiura M., Wanner BL., Mori H., Mizuno T., 2002, Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12., Mol Microbiol 46(1):281-91

 [18] Dartigalongue C., Raina S., 1998, A new heat-shock gene, ppiD, encodes a peptidyl-prolyl isomerase required for folding of outer membrane proteins in Escherichia coli., EMBO J 17(14):3968-80

 [19] Zahrl D., Wagner M., Bischof K., Koraimann G., 2006, Expression and assembly of a functional type IV secretion system elicit extracytoplasmic and cytoplasmic stress responses in Escherichia coli., J Bacteriol 188(18):6611-21

 [20] Raffa RG., Raivio TL., 2002, A third envelope stress signal transduction pathway in Escherichia coli., Mol Microbiol 45(6):1599-611

 [21] Raivio TL., Laird MW., Joly JC., Silhavy TJ., 2000, Tethering of CpxP to the inner membrane prevents spheroplast induction of the cpx envelope stress response., Mol Microbiol 37(5):1186-97

 [22] Danese PN., Silhavy TJ., 1997, The sigma(E) and the Cpx signal transduction systems control the synthesis of periplasmic protein-folding enzymes in Escherichia coli., Genes Dev 11(9):1183-93

 [23] Ogasawara H., Teramoto J., Hirao K., Yamamoto K., Ishihama A., Utsumi R., 2004, Negative regulation of DNA repair gene (ung) expression by the CpxR/CpxA two-component system in Escherichia coli K-12 and induction of mutations by increased expression of CpxR., J Bacteriol 186(24):8317-25

 [24] McEwen J, Silverman P, 1980, Genetic analysis of Escherichia coli K-12 chromosomal mutants defective in expression of F-plasmid functions: identification of genes cpxA and cpxB., J Bacteriol, 1980 Oct

 [25] Lau-Wong IC, Locke T, Ellison MJ, Raivio TL, Frost LS, 2008, Activation of the Cpx regulon destabilizes the F plasmid transfer activator, TraJ, via the HslVU protease in Escherichia coli., Mol Microbiol, 2008 Feb

 [26] Dorel C., Lejeune P., Rodrigue A., 2006, The Cpx system of Escherichia coli, a strategic signaling pathway for confronting adverse conditions and for settling biofilm communities?, Res Microbiol 157(4):306-14

 [27] Raivio TL, 2005, Envelope stress responses and Gram-negative bacterial pathogenesis., Mol Microbiol, 2005 Jun

 [28] Dong J., Iuchi S., Kwan HS., Lu Z., Lin EC., 1993, The deduced amino-acid sequence of the cloned cpxR gene suggests the protein is the cognate regulator for the membrane sensor, CpxA, in a two-component signal transduction system of Escherichia coli., Gene 136(1-2):227-30

 [29] Snyder WB, Davis LJ, Danese PN, Cosma CL, Silhavy TJ, 1995, Overproduction of NlpE, a new outer membrane lipoprotein, suppresses the toxicity of periplasmic LacZ by activation of the Cpx signal transduction pathway., J Bacteriol, 1995 Aug

 [30] Otto K, Silhavy TJ, 2002, Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway., Proc Natl Acad Sci U S A, 2002 Feb 19

 [31] Gupta SD., Lee BT., Camakaris J., Wu HC., 1995, Identification of cutC and cutF (nlpE) genes involved in copper tolerance in Escherichia coli., J Bacteriol 177(15):4207-15

 [32] Fleischer R, Heermann R, Jung K, Hunke S, 2007, Purification, reconstitution, and characterization of the CpxRAP envelope stress system of Escherichia coli., J Biol Chem, 2007 Mar 23

 [33] Buelow DR, Raivio TL, 2005, Cpx signal transduction is influenced by a conserved N-terminal domain in the novel inhibitor CpxP and the periplasmic protease DegP., J Bacteriol, 2005 Oct

 [34] Isaac DD, Pinkner JS, Hultgren SJ, Silhavy TJ, 2005, The extracytoplasmic adaptor protein CpxP is degraded with substrate by DegP., Proc Natl Acad Sci U S A, 2005 Dec 6

 [35] Raivio TL, Silhavy TJ, 1997, Transduction of envelope stress in Escherichia coli by the Cpx two-component system., J Bacteriol, 1997 Dec

 [36] Wolfe AJ, Parikh N, Lima BP, Zemaitaitis B, 2008, Signal integration by the two-component signal transduction response regulator CpxR., J Bacteriol, 2008 Apr

 [37] Lima BP, Thanh Huyen TT, Bäsell K, Becher D, Antelmann H, Wolfe AJ, 2012, Inhibition of acetyl phosphate-dependent transcription by an acetylatable lysine on RNA polymerase., J Biol Chem, 2012 Sep 14

 [38] Lima BP, Lennon CW, Ross W, Gourse RL, Wolfe AJ, 2016, In vitro evidence that RNA Polymerase acetylation and acetyl phosphate-dependent CpxR phosphorylation affect cpxP transcription regulation., FEMS Microbiol Lett, 2016 Mar

 [39] Itou H, Tanaka I, 2001, The OmpR-family of proteins: insight into the tertiary structure and functions of two-component regulator proteins., J Biochem, 2001 Mar

 [40] Bachhawat P, Stock AM, 2007, Crystal structures of the receiver domain of the response regulator PhoP from Escherichia coli in the absence and presence of the phosphoryl analog beryllofluoride., J Bacteriol, 2007 Aug

 [41] Mechaly AE, Sassoon N, Betton JM, Alzari PM, 2014, Segmental helical motions and dynamical asymmetry modulate histidine kinase autophosphorylation., PLoS Biol, 2014 Jan

 [42] Mechaly AE, Soto Diaz S, Sassoon N, Buschiazzo A, Betton JM, Alzari PM, 2017, Structural Coupling between Autokinase and Phosphotransferase Reactions in a Bacterial Histidine Kinase., Structure, 2017 Jun 6

 [43] Mechaly AE, Haouz A, Sassoon N, Buschiazzo A, Betton JM, Alzari PM, 2018, Conformational plasticity of the response regulator CpxR, a key player in Gammaproteobacteria virulence and drug-resistance., J Struct Biol, 2018 Nov

 [44] Raivio TL, Silhavy TJ, 1999, The sigmaE and Cpx regulatory pathways: overlapping but distinct envelope stress responses., Curr Opin Microbiol, 1999 Apr

 [45] Nie T, Zhang C, Huang A, Li P, 2018, Epigallocatechin Gallate-Mediated Cell Death Is Triggered by Accumulation of Reactive Oxygen Species Induced via the Cpx Two-Component System in Escherichia coli., Front Microbiol, 2018



RegulonDB