RegulonDB RegulonDB 10.8:Regulon Page
   

ModE DNA-binding transcriptional dual regulator

Synonyms: ModE-MoO42-, ModE
Summary:
The transcription factor ModE, for "Molybdenum," is the principal regulator that controls the transcription of operons involved in the transport of molybdenum and synthesis of molybdoenzymes and molybdate-related functions, among others [1, 7, 8, 9, 10, 11, 12]. The regulatory effect of ModE is induced when E. coli is grown under anaerobic growth conditions and when the physiological inducer, molybdenum, binds to ModE and promotes the dimerization of the ModE-Mo complex [1, 8]. The ModE dimer binds two molecules of molybdenum with a Kd of 0.8 mM. Tungsten can act as a substitute for Mo in ModE binding to the modABCD promoter in vitro, but the complex may be biologically inactive [12]. The binding targets for ModE consist of inverted repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [1, 6, 8]. A crystal structure of ModE has been solved at 2.1Å resolution []. The monomer of this transcription factor contains two domains: the N-terminal domain is responsible for binding DNA and the dimerization and also contains a winged helix-turn-helix motif [].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
ModE Non-Functional   Apo [BPP], [IPI] [1]
ModE-MoO42- Functional Allosteric Holo [APPHINH], [AUPEINH], [BPP], [HIFS], [IPI] [1], [2], [3], [4], [5], [6]
Evolutionary Family: LysR
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: modE
  Genome position: 793856-794644
  Length: 789 bp / 262 aa
Operon name: modEF
TU(s) encoding the TF:
Transcription unit        Promoter
 
 


Regulon       
Regulated gene(s) ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH, deoA, deoB, deoC, deoD, dmsA, dmsB, dmsC, hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, hycI, moaA, moaB, moaC, moaD, moaE, modA, modB, modC, napA, napB, napC, napD, napF, napG, napH, narL, narX, oppA, oppB, oppC, oppD, oppF
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (16)
anaerobic respiration (11)
cytochromes (10)
chaperoning, repair (refolding) (10)
fermentation (8)
Read more >
Regulated operon(s) deoCABD, dmsABC, hycABCDEFGHI, moaABCDE, modABC, napFDAGHBC-ccmABCDEFGH, narXL, oppABCDF
First gene in the operon(s) deoC, dmsA, hycA, moaA, modA, napF, napF, narX, oppA
Simple and complex regulons ArcA,Fur,Lrp,ModE
CRP,CytR,DeoR,Fis,ModE
CRP,ModE
FNR,FlhDC,ModE,NarL,NarP
FNR,ModE
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[ModE,-](4)
[ModE,+](5)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  ModE-MoO42- repressor deoCp2 Sigma70 -35.0 -80.0 deoC, deoA, deoB, deoD
ttccttaattGTGATGTGTATCGAAGTGTGTTGCggagtagatg
4617231 4617254 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [7]
  ModE-MoO42- repressor dmsAp2 nd -5.0 -86.0 dmsA, dmsB, dmsC
ttcaaattatTCGATGTATACAAGCCTATATAGCgaactgctat
940861 940884 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [2]
  ModE-MoO42- activator hycAp Sigma54 -192.0 -218.0 hycA, hycB, hycC, hycD, hycE, hycF, hycG, hycH, hycI
cccgttggcaGAGGGTTATTTCGTGCATATCGCCtcccattaac
2850641 2850664 [BPP], [GEA] [8]
  ModE-MoO42- activator moaAp2 nd -57.5 -187.5 moaA, moaB, moaC, moaD, moaE
acgatcatgaCGCTATATACATGATTACATAGCGaaagtgtgga
816845 816868 [BPP], [GEA] [4]
  ModE-MoO42- repressor modAp Sigma70 -4.5 -31.5 modA, modB, modC
ccgagttagtCGTTATATTGTCGCCTACATAACGttacattaag
795046 795069 [BPP], [CV(SM)], [GEA], [SM] [1]
  ModE-MoO42- activator napFp1 Sigma70 -133.5 -210.5 napF, napD, napA, napG, napH, napB, napC, ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH
gtgaatcaatCGCTATATAAATATATTTATAACCatttgaaatg
2303696 2303719 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [5], [9]
  ModE-MoO42- activator napFp2 Sigma70 -130.5 -210.5 napF, napD, napA, napG, napH, napB, napC, ccmA, ccmB, ccmC, ccmD, ccmE, ccmF, ccmG, ccmH
gtgaatcaatCGCTATATAAATATATTTATAACCatttgaaatg
2303696 2303719 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [5], [9]
  ModE-MoO42- activator narXp Sigma70 -141.5 -300.5 narX, narL
cgtttcgatgTCTGCCACCTTAGTGTCTGTAGCTaaaggcaatt
1277907 1277930 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [8]
  ModE-MoO42- repressor oppAp Sigma28 nd nd oppA, oppB, oppC, oppD, oppF nd nd [GEA] [7]


Alignment and PSSM for ModE TFBSs    

Aligned TFBS of ModE   
  Sequence
  CGCTATATACATGATTACATAGCGAAA
  CGATGTATACAAGCCTATATAGCGAAC
  CGTTATATTGTCGCCTACATAACGTTA
  CGCAACACACTTCGATACACATCACAA
  CGATATGCACGAAATAACCCTCTGCCA
  GGTTATAAATATATTTATATAGCGATT
  CGATGTCTGCCACCTTAGTGTCTGTAG

Position weight matrix (PWM). ModE matrix-quality result   
A	0	0	3	1	5	0	5	1	5	0	3	3	2	2	1	1	7	0	5	0	5	1	0	1	3	4	4
C	6	0	2	0	0	1	1	2	0	5	1	1	2	3	2	0	0	4	1	2	0	2	5	0	2	1	1
G	1	7	0	0	2	0	1	0	1	1	1	0	3	1	0	0	0	1	0	1	0	3	0	6	0	0	1
T	0	0	2	6	0	6	0	4	1	1	2	3	0	1	4	6	0	2	1	4	2	1	2	0	2	2	1

Consensus   
;	consensus.strict             	CGatatataCaagcttAcatagCGaaa
;	consensus.strict.rc          	TTTCGCTATGTAAGCTTGTATATATCG
;	consensus.IUPAC              	CGmtrtayaCawscytAcayasCGmaa
;	consensus.IUPAC.rc           	TTKCGSTRTGTARGSWTGTRTAYAKCG
;	consensus.regexp             	CG[ac]t[ag]ta[ct]aCa[at][cg]c[ct]tAca[ct]a[cg]CG[ac]aa
;	consensus.regexp.rc          	TT[GT]CG[CG]T[AG]TGTA[AG]G[CG][AT]TGT[AG]TA[CT]A[GT]CG

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [IPI] Inferred from physical interaction

 [APPHINH] Assay of protein purified to homogeneity from its native host

 [AUPEINH] Assay of unpurified protein expressed in its native host

 [HIFS] Human inference of function from sequence

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [CV(GEA)] cross validation(GEA)

 [GEA] Gene expression analysis

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [SM] Site mutation



Reference(s)    

 [1] Grunden AM., Self WT., Villain M., Blalock JE., Shanmugam KT., 1999, An analysis of the binding of repressor protein ModE to modABCD (molybdate transport) operator/promoter DNA of Escherichia coli., J Biol Chem 274(34):24308-15

 [2] McNicholas PM., Chiang RC., Gunsalus RP., 1998, Anaerobic regulation of the Escherichia coli dmsABC operon requires the molybdate-responsive regulator ModE., Mol Microbiol 27(1):197-208

 [3] McNicholas PM., Mazzotta MM., Rech SA., Gunsalus RP., 1998, Functional dissection of the molybdate-responsive transcription regulator, ModE, from Escherichia coli., J Bacteriol 180(17):4638-43

 [4] McNicholas PM., Rech SA., Gunsalus RP., 1997, Characterization of the ModE DNA-binding sites in the control regions of modABCD and moaABCDE of Escherichia coli., Mol Microbiol 23(3):515-24

 [5] Stewart V., Bledsoe PJ., Williams SB., 2003, Dual overlapping promoters control napF (periplasmic nitrate reductase) operon expression in Escherichia coli K-12., J Bacteriol 185(19):5862-70

 [6] Studholme DJ., Pau RN., 2003, A DNA element recognised by the molybdenum-responsive transcription factor ModE is conserved in Proteobacteria, green sulphur bacteria and Archaea., BMC Microbiol 3:24

 [7] Tao H., Hasona A., Do PM., Ingram LO., Shanmugam KT., 2005, Global gene expression analysis revealed an unsuspected deo operon under the control of molybdate sensor, ModE protein, in Escherichia coli., Arch Microbiol 184(4):225-33

 [8] Self WT., Grunden AM., Hasona A., Shanmugam KT., 1999, Transcriptional regulation of molybdoenzyme synthesis in Escherichia coli in response to molybdenum: ModE-molybdate, a repressor of the modABCD (molybdate transport) operon is a secondary transcriptional activator for the hyc and nar operons., Microbiology 145 ( Pt 1):41-55

 [9] McNicholas PM., Gunsalus RP., 2002, The molybdate-responsive Escherichia coli ModE transcriptional regulator coordinates periplasmic nitrate reductase (napFDAGHBC) operon expression with nitrate and molybdate availability., J Bacteriol 184(12):3253-9

 [10] Grunden AM., Ray RM., Rosentel JK., Healy FG., Shanmugam KT., 1996, Repression of the Escherichia coli modABCD (molybdate transport) operon by ModE., J Bacteriol 178(3):735-44

 [11] Hasona A, Self WT, Ray RM, Shanmugam KT, 1998, Molybdate-dependent transcription of hyc and nar operons of Escherichia coli requires MoeA protein and ModE-molybdate., FEMS Microbiol Lett, 1998 Dec 1

 [12] Anderson LA., McNairn E., Lubke T., Pau RN., Boxer DH., Leubke T., 2000, ModE-dependent molybdate regulation of the molybdenum cofactor operon moa in Escherichia coli., J Bacteriol 182(24):7035-43



RegulonDB