RegulonDB RegulonDB 9.3:Regulon Page
   

Mlc DNA-binding transcriptional repressor

Synonyms: Mlc, Mlc-EIIGlC
Summary:
DgsA, better known as Mlc, makes large colonies, |CITS:[7766024]| is a transcriptional dual
regulator that controls the expression of a number of genes encoding enzymes of the Escherichia coli
phosphotransferase (PTS) and phosphoenolpyruvate (PEP) systems |CITS:[ 11934616 ][16519088]|. It also regulates genes
involved in the uptake of glucose |CITS:[11139621]|. It is considered a global regulator of carbohydrate metabolism
|CITS: [9484893][9781886]|. In addition, Mlc regulates expression of the MalT transcriptional regulator, the activator of the
maltose regulon |CITS: [9484893]|.
Mlc repressor function is disabled by binding of Mlc to an actively-transported and dephosphorylated form of PtsG
(EIICBGlc) |CITS:[11032803][11157755]|. The membrane-bound part of EIICBGlc is essential for
Mlc inactivation |CITS: [11157755][12529317]|. Analysis of the crystal structures of the tetrameric Mlc/EIIB complex shows a
molecular mechanism of Mlc inactivation by membrane sequestration, in which Mlc loses its DNA binding ability in vivo
due to the conformational obstruction by EIIB molecules |CITS:[18319344]|. Mlc is able to bind to the dephosphorylated EIIB domain of NagE when the NagE level is high |CITS:[ 26293172]|.
The crystal structure of Mlc has been determined |CITS:[16510988][15929984]| to 2.85 and 2.7 Å resolution and Mlc in
complex with four molecules of enzyme IIBGlc (EIIB) |CITS: [18319344]| to 2.85 Å resolution.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
Mlc Functional   Apo [BPP], [IDA], [IEP], [IPI] [1], [2], [3]
Mlc-EIIGlC Non-Functional Allosteric Holo [BPP], [IDA], [IEP], [IPI] [1], [2], [3]
Evolutionary Family: ROK
Connectivity class: Local Regulator
Gene name: mlc
  Genome position: 1667344-1668564
  Length: 1221 bp / 406 aa
Operon name: mlc-ynfK
TU(s) encoding the TF:
Transcription unit        Promoter
mlc
mlcp1
mlc-ynfK
mlcp2


Regulon       
Regulated gene(s) crr, malT, manX, manY, manZ, mlc, ptsG, ptsH, ptsI, ynfK
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Phosphotransferase Systems (PEP-dependent PTS) (5)
membrane (4)
Transcription related (2)
operon (2)
Read more >
Regulated operon(s) malT, manXYZ, mlc-ynfK, ptsG, ptsHI-crr
First gene in the operon(s) malT, manX, mlc, mlc, ptsG, ptsG, ptsH
Simple and complex regulons ArcA,CRP,Fis,Mlc,SoxS
CRP,Cra,Mlc,NagC
CRP,Lrp,Mlc
CRP,Mlc
CRP,Mlc,NagC
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[Mlc,-](7)


Transcription factor binding sites (TFBSs) arrangements       

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  Mlc repressor malTp Sigma70 12.0 -50.0 malT
ccttataaccATTAATTACGAAGCGCAAAAAAAataatatttc
3553024 3553046 [BCE], [GEA], [HIBSCS] [4], [5]
  Mlc repressor manXp Sigma70 -79.0 -194.0 manX, manY, manZ
tgtgacaaggATATTTTACCTTTCGAAATTTCTgctaatcgaa
1901843 1901865 [BCE], [GEA] [6]
  Mlc repressor manXp Sigma70 -13.0 -128.0 manX, manY, manZ
cataaaataaTTTTTTCGATATCTAAAATAAATcgcgaaacgc
1901909 1901931 [BCE], [GEA] [6]
  Mlc repressor mlcp1 Sigma70 16.0 -24.0 mlc
tagcctacagATTATTTCGGAGCGCGAAAATATagggagtatg
1668577 1668599 [BCE], [GEA], [HIBSCS] [4], [5], [7]
  Mlc repressor mlcp2 Sigma70 4.0 -24.0 mlc, ynfK
tagcctacagATTATTTCGGAGCGCGAAAATATagggagtatg
1668577 1668599 [BCE], [GEA], [HIBSCS] [4], [5], [7]
  Mlc repressor ptsGp1 nd -6.0 -109.0 ptsG
tggcactgaaTTATTTTACTCTGTGTAATAAATaaagggcgct
1157749 1157771 [BPP], [GEA], [HIBSCS] [5], [8], [9]
  Mlc repressor ptsGp2 Sigma70 -35.0 -278.0 ptsG
gttgaatgagTTTTTTTAAAGCTCGTAATTAATggctaaaacg
1157580 1157602 [BPP], [GEA], [HIBSCS] [5], [8]
  Mlc repressor ptsHp4 Sigma70 13.0 -251.0 ptsH, ptsI, crr
aaccagactaATTATTTTGATGCGCGAAATTAAtcgttacagg
2533502 2533524 [BPP], [GEA], [HIBSCS] [5], [10], [11]


Alignment and PSSM for Mlc TFBSs    

Aligned TFBS of Mlc   
  Sequence
  TTTTTTTAAAGCTCGTAATTAAT
  TTATTTTACTCTGTGTAATAAAT
  TTATTTCGGAGCGCGAAAATATA
  ATATTTTACCTTTCGAAATTTCT
  TTATTTTAGATATCGAAAAAATT
  TTATTTTGATGCGCGAAATTAAT
  TTTTTTTGCGCTTCGTAATTAAT

Position weight matrix (PWM).   
A	1	0	5	0	0	0	0	4	2	3	0	1	0	0	0	4	7	7	2	2	6	4	1
C	0	0	0	0	0	0	1	0	3	1	2	3	0	6	0	0	0	0	0	0	0	1	0
G	0	0	0	0	0	0	0	3	2	1	3	0	3	0	7	0	0	0	0	0	0	0	0
T	6	7	2	7	7	7	6	0	0	2	2	3	4	1	0	3	0	0	5	5	1	2	6

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [IDA] Inferred from direct assay

 [IEP] Inferred from expression pattern

 [IPI] Inferred from physical interaction

 [BCE] Binding of cellular extracts

 [GEA] Gene expression analysis

 [HIBSCS] Human inference based on similarity to consensus sequences



Reference(s)    

 [1] Lee SJ., Boos W., Bouche JP., Plumbridge J., 2000, Signal transduction between a membrane-bound transporter, PtsG, and a soluble transcription factor, Mlc, of Escherichia coli., EMBO J. 19(20):5353-61

 [2] Nam TW., Cho SH., Shin D., Kim JH., Jeong JY., Lee JH., Roe JH., Peterkofsky A., Kang SO., Ryu S., Seok YJ., 2001, The Escherichia coli glucose transporter enzyme IICB(Glc) recruits the global repressor Mlc., EMBO J. 20(3):491-8

 [3] Nam TW., Jung HI., An YJ., Park YH., Lee SH., Seok YJ., Cha SS., 2008, Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc inactivation by membrane sequestration., Proc Natl Acad Sci U S A. 105(10):3751-6

 [4] Decker K., Plumbridge J., Boos W., 1998, Negative transcriptional regulation of a positive regulator: the expression of malT, encoding the transcriptional activator of the maltose regulon of Escherichia coli, is negatively controlled by Mlc., Mol Microbiol. 27(2):381-90

 [5] Plumbridge J., 2001, DNA binding sites for the Mlc and NagC proteins: regulation of nagE, encoding the N-acetylglucosamine-specific transporter in Escherichia coli., Nucleic Acids Res. 29(2):506-14

 [6] Plumbridge J., 1998, Control of the expression of the manXYZ operon in Escherichia coli: Mlc is a negative regulator of the mannose PTS., Mol Microbiol. 27(2):369-80

 [7] Shin D., Lim S., Seok YJ., Ryu S., 2001, Heat shock RNA polymerase (E sigma(32)) is involved in the transcription of mlc and crucial for induction of the Mlc regulon by glucose in Escherichia coli., J Biol Chem. 276(28):25871-5

 [8] Plumbridge J., 1998, Expression of ptsG, the gene for the major glucose PTS transporter in Escherichia coli, is repressed by Mlc and induced by growth on glucose., Mol Microbiol. 29(4):1053-63

 [9] Shin D., Cho N., Heu S., Ryu S., 2003, Selective regulation of ptsG expression by Fis. Formation of either activating or repressing nucleoprotein complex in response to glucose., J Biol Chem. 278(17):14776-81

 [10] Kim SY., Nam TW., Shin D., Koo BM., Seok YJ., Ryu S., 1999, Purification of Mlc and analysis of its effects on the pts expression in Escherichia coli., J Biol Chem. 274(36):25398-402

 [11] Tanaka Y., Kimata K., Inada T., Tagami H., Aiba H., 1999, Negative regulation of the pts operon by Mlc: mechanism underlying glucose induction in Escherichia coli., Genes Cells. 4(7):391-9



RegulonDB