RegulonDB RegulonDB 11.0:Regulon Page
   

Mlc DNA-binding transcriptional repressor

Synonyms: Mlc-EIIGlC, Mlc
Summary:
DgsA, better known as Mlc, "makes large colonies," [10]is a transcriptional dual regulator that controls the expression of a number of genes encoding enzymes of the Escherichia coli phosphotransferase (PTS) and phosphoenolpyruvate (PEP) systems [11, 12] It also regulates genes involved in the uptake of glucose [13] It is considered a global regulator of carbohydrate metabolism [3, 14]. In addition, Mlc regulates expression of the MalT transcriptional regulator, the activator of the maltose regulon [3]. Mlc repressor function is disabled by binding of Mlc to an actively-transported and dephosphorylated form of PtsG (EIICBGlc) [1, 2] The membrane-bound part of EIICBGlc is essential for Mlc inactivation [2, 15].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
Mlc Functional   Apo [BPP], [IDA], [IEP] [1], [2]
Mlc-EIIGlC Non-Functional Allosteric Holo [BPP], [IDA], [IEP] [1], [2]
Evolutionary Family: ROK
TFBs length: 23
TFBs symmetry: inverted-repeat
Connectivity class: Local Regulator
Gene name: mlc
  Genome position: 1667344-1668564
  Length: 1221 bp / 406 aa
Operon name: mlc-bidA
TU(s) encoding the TF:
Transcription unit        Promoter
mlc
mlcp1
mlc-ynfK
mlcp
mlc-ynfK
mlcp2


Regulon       
Regulated gene(s) bidA, crr, malT, manX, manY, manZ, mlc, ptsG, ptsH, ptsI
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Phosphotransferase Systems (PEP-dependent PTS) (5)
membrane (4)
Transcription related (2)
operon (2)
Read more >
Regulated operon(s) malT, manXYZ, mlc-bidA, ptsG, ptsHI-crr
First gene in the operon(s) malT, manX, mlc, ptsG, ptsH
Simple and complex regulons ArcA,CRP,Fis,Mlc,SoxS
CRP,Cra,Mlc,NagC
CRP,Lrp,Mlc
CRP,Mlc
CRP,Mlc,NagC
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[Mlc,-](9)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  Mlc repressor malTp Sigma70 12.0 -50.0 malT
ccttataaccATTAATTACGAAGCGCAAAAAAAataatatttc
3553024 3553046 [GEA], [APIORCISFBSCS], [BCE] [3]
  Mlc repressor manXp Sigma70 -79.0 -194.0 manX, manY, manZ
tgtgacaaggATATTTTACCTTTCGAAATTTCTgctaatcgaa
1901843 1901865 [GEA], [BCE] [4]
  Mlc repressor manXp Sigma70 -13.0 -128.0 manX, manY, manZ
cataaaataaTTTTTTCGATATCTAAAATAAATcgcgaaacgc
1901909 1901931 [GEA], [BCE] [4]
  Mlc repressor mlcp Sigma32 4.0 -24.0 mlc, bidA
tagcctacagATTATTTCGGAGCGCGAAAATATagggagtatg
1668577 1668599 [GEA], [APIORCISFBSCS], [BCE] [3], [5]
  Mlc repressor mlcp1 Sigma70 16.0 -24.0 mlc
tagcctacagATTATTTCGGAGCGCGAAAATATagggagtatg
1668577 1668599 [GEA], [APIORCISFBSCS], [BCE] [3], [5]
  Mlc repressor mlcp2 Sigma70 4.0 -24.0 mlc, bidA
tagcctacagATTATTTCGGAGCGCGAAAATATagggagtatg
1668577 1668599 [GEA], [APIORCISFBSCS], [BCE] [3], [5]
  Mlc repressor ptsGp1 nd -6.0 -109.0 ptsG
tggcactgaaTTATTTTACTCTGTGTAATAAATaaagggcgct
1157749 1157771 [GEA], [APIORCISFBSCS], [BPP] [6], [7]
  Mlc repressor ptsGp2 Sigma70 -35.0 -278.0 ptsG
gttgaatgagTTTTTTTAAAGCTCGTAATTAATggctaaaacg
1157580 1157602 [GEA], [APIORCISFBSCS], [BPP] [6]
  Mlc repressor ptsHp Sigma32 13.0 -251.0 ptsH, ptsI, crr
aaccagactaATTATTTTGATGCGCGAAATTAAtcgttacagg
2533502 2533524 [GEA], [APIORCISFBSCS], [BPP] [8], [9]
  Mlc repressor ptsHp4 Sigma70 13.0 -251.0 ptsH, ptsI, crr
aaccagactaATTATTTTGATGCGCGAAATTAAtcgttacagg
2533502 2533524 [GEA], [APIORCISFBSCS], [BPP] [8], [9]


Alignment and PSSM for Mlc TFBSs    

Aligned TFBS of Mlc   
  Sequence
  AGTTTTTTTAAAGCTCGTAATTAATG
  AATTATTTTGATGCGCGAAATTAATC
  ATTTTTTTTGCGCTTCGTAATTAATG
  AATTATTTTACTCTGTGTAATAAATA
  GATTATTTCGGAGCGCGAAAATATAG
  ATTTATTTTAGATATCGAAAAAATTA
  GGATATTTTACCTTTCGAAATTTCTG

Position weight matrix (PWM). Mlc matrix-quality result   
A	5	3	1	0	5	0	0	0	0	4	2	3	0	1	0	0	0	4	7	7	2	2	6	4	1	2
C	0	0	0	0	0	0	0	0	1	0	3	1	2	3	0	6	0	0	0	0	0	0	0	1	0	1
G	2	2	0	0	0	0	0	0	0	3	2	1	3	0	3	0	7	0	0	0	0	0	0	0	0	4
T	0	2	6	7	2	7	7	7	6	0	0	2	2	3	4	1	0	3	0	0	5	5	1	2	6	0

Consensus   
;	consensus.strict             	aatTaTTTtgcagcgCGaAAttaatg
;	consensus.strict.rc          	CATTAATTTCGCGCTGCAAAATAATT
;	consensus.IUPAC              	rrtTaTTTtrsasykCGwAAttaatg
;	consensus.IUPAC.rc           	CATTAATTWCGMRSTSYAAAATAAYY
;	consensus.regexp             	[ag][ag]tTaTTTt[ag][cg]a[cg][ct][gt]CG[at]AAttaatg
;	consensus.regexp.rc          	CATTAATT[AT]CG[AC][AG][CG]T[CG][CT]AAAATAA[CT][CT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Lee SJ., Boos W., Bouche JP., Plumbridge J., 2000, Signal transduction between a membrane-bound transporter, PtsG, and a soluble transcription factor, Mlc, of Escherichia coli., EMBO J 19(20):5353-61

 [2] Nam TW., Cho SH., Shin D., Kim JH., Jeong JY., Lee JH., Roe JH., Peterkofsky A., Kang SO., Ryu S., Seok YJ., 2001, The Escherichia coli glucose transporter enzyme IICB(Glc) recruits the global repressor Mlc., EMBO J 20(3):491-8

 [3] Decker K., Plumbridge J., Boos W., 1998, Negative transcriptional regulation of a positive regulator: the expression of malT, encoding the transcriptional activator of the maltose regulon of Escherichia coli, is negatively controlled by Mlc., Mol Microbiol 27(2):381-90

 [4] Plumbridge J., 1998, Control of the expression of the manXYZ operon in Escherichia coli: Mlc is a negative regulator of the mannose PTS., Mol Microbiol 27(2):369-80

 [5] Shin D., Lim S., Seok YJ., Ryu S., 2001, Heat shock RNA polymerase (E sigma(32)) is involved in the transcription of mlc and crucial for induction of the Mlc regulon by glucose in Escherichia coli., J Biol Chem 276(28):25871-5

 [6] Plumbridge J., 1998, Expression of ptsG, the gene for the major glucose PTS transporter in Escherichia coli, is repressed by Mlc and induced by growth on glucose., Mol Microbiol 29(4):1053-63

 [7] Shin D., Cho N., Heu S., Ryu S., 2003, Selective regulation of ptsG expression by Fis. Formation of either activating or repressing nucleoprotein complex in response to glucose., J Biol Chem 278(17):14776-81

 [8] Kim SY., Nam TW., Shin D., Koo BM., Seok YJ., Ryu S., 1999, Purification of Mlc and analysis of its effects on the pts expression in Escherichia coli., J Biol Chem 274(36):25398-402

 [9] Tanaka Y., Kimata K., Inada T., Tagami H., Aiba H., 1999, Negative regulation of the pts operon by Mlc: mechanism underlying glucose induction in Escherichia coli., Genes Cells 4(7):391-9

 [10] Hosono K, Kakuda H, Ichihara S, 1995, Decreasing accumulation of acetate in a rich medium by Escherichia coli on introduction of genes on a multicopy plasmid., Biosci Biotechnol Biochem, 59(2):256 10.1271/bbb.59.256

 [11] Plumbridge J, 2002, Regulation of gene expression in the PTS in Escherichia coli: the role and interactions of Mlc., Curr Opin Microbiol, 5(2):187 10.1016/s1369-5274(02)00296-5

 [12] Pradhanang V, Ghimire S, 2005, Hirsutism: a rare presentation of an adult granulosa cell tumor of ovary., Nepal Med Coll J, 7(2):152 None

 [13] Plumbridge J., 2001, DNA binding sites for the Mlc and NagC proteins: regulation of nagE, encoding the N-acetylglucosamine-specific transporter in Escherichia coli., Nucleic Acids Res 29(2):506-14

 [14] Kimata K., Inada T., Tagami H., Aiba H., 1998, A global repressor (Mlc) is involved in glucose induction of the ptsG gene encoding major glucose transporter in Escherichia coli., Mol Microbiol 29(6):1509-19

 [15] Seitz S, Lee SJ, Pennetier C, Boos W, Plumbridge J, 2003, Analysis of the interaction between the global regulator Mlc and EIIBGlc of the glucose-specific phosphotransferase system in Escherichia coli., J Biol Chem, 278(12):10744 10.1074/jbc.M212066200

 [16] Nam TW, Jung HI, An YJ, Park YH, Lee SH, Seok YJ, Cha SS, 2008, Analyses of Mlc-IIBGlc interaction and a plausible molecular mechanism of Mlc inactivation by membrane sequestration., Proc Natl Acad Sci U S A, 105(10):3751 10.1073/pnas.0709295105

 [17] Bréchemier-Baey D, Pennetier C, Plumbridge J, 2015, Dual inducer signal recognition by an Mlc homologue., Microbiology (Reading), 161(8):1694 10.1099/mic.0.000126

 [18] Gerber K, Boos W, Welte W, Schiefner A, 2005, Crystallization and preliminary X-ray analysis of Mlc from Escherichia coli., Acta Crystallogr Sect F Struct Biol Cryst Commun, 61(Pt 2):183 10.1107/S1744309104033640

 [19] Schiefner A, Gerber K, Seitz S, Welte W, Diederichs K, Boos W, 2005, The crystal structure of Mlc, a global regulator of sugar metabolism in Escherichia coli., J Biol Chem, 280(32):29073 10.1074/jbc.M504215200

 [20] Cho S., Shin D., Ji GE., Heu S., Ryu S., 2005, High-level recombinant protein production by overexpression of Mlc in Escherichia coli., J Biotechnol 119(2):197-203

 [21] Becker AK., Zeppenfeld T., Staab A., Seitz S., Boos W., Morita T., Aiba H., Mahr K., Titgemeyer F., Jahreis K., 2006, YeeI, a Novel Protein Involved in Modulation of the Activity of the Glucose-Phosphotransferase System in Escherichia coli K-12., J Bacteriol 188(15):5439-49

 [22] Titgemeyer F, Reizer J, Reizer A, Saier MH, 1994, Evolutionary relationships between sugar kinases and transcriptional repressors in bacteria., Microbiology (Reading), 140 ( Pt 9)(None):2349 10.1099/13500872-140-9-2349

 [23] Hansen T, Reichstein B, Schmid R, Schönheit P, 2002, The first archaeal ATP-dependent glucokinase, from the hyperthermophilic crenarchaeon Aeropyrum pernix, represents a monomeric, extremely thermophilic ROK glucokinase with broad hexose specificity., J Bacteriol, 184(21):5955 10.1128/JB.184.21.5955-5965.2002



RegulonDB