RegulonDB RegulonDB 10.8:Regulon Page
   

SoxS DNA-binding transcriptional dual regulator

Synonyms: SoxS
Summary:
SoxS is a dual transcriptional activator and participates in the removal of superoxide and nitric oxide and protection from organic solvents and antibiotics [1, 5, 31, 35]. SoxS shares 49% identity with MarA and the N-terminal domain of Rob [36]. These proteins activate a common set of about 50 target genes [8, 13], the marA/soxS/rob regulon, involved in antibiotic resistance [19, 37], superoxide resistance [35, 38], and tolerance to organic solvents [] and heavy metals []. The activity of each protein is induced by different signals: the activity of Rob is increased with dipyridyl, bile salts, or decanoate [39], and the activities of MarA and SoxS are increased by the aromatic weak acid salicylate [13, 40] and by oxidative stress [], respectively.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
SoxS Functional   [IE] [1], [2], [3], [4], [5], [6], [7]
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: soxS
  Genome position: 4277060-4277383
  Length: 324 bp / 107 aa
Operon name: soxS
TU(s) encoding the TF:
Transcription unit        Promoter
soxS
soxSp


Regulon       
Regulated gene(s) acnA, acrA, acrB, acrZ, aldA, decR, fldA, fldB, fpr, fumC, fur, inaA, marA, marB, marR, micF, nepI, nfo, nfsA, nfsB, ompN, ompW, pgi, poxB, pqiA, pqiB, pqiC, ptsG, ribA, rimK, rob, sodA, soxS, tolC, uof, waaY, waaZ, ybjC, ybjN, ydbK, ygiB, ygiC, yrbL, zinT, zwf
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (8)
drug resistance/sensitivity (7)
Transcription related (6)
activator (5)
repressor (5)
Read more >
Regulated operon(s) acrAB, acrZ, aldA, decR, fldA-uof-fur, fldB, fpr, fumAC, hcp-hcr-poxB-ltaE-ybjT, inaA, marRAB, micF, nepI, nfo, nfsB, ompW, pgi, pqiABC, ptsG, ribA, rirA-waaQGPSBOJYZU, rob, sodA, soxS, tolC-ygiBC, ybjC-nfsA-rimK-ybjN, ydbK-ompN, ymiC-acnA, yrbL, zinT, zwf
First gene in the operon(s) acnA, acrA, acrZ, aldA, decR, fldA, fldB, fpr, fumC, inaA, marR, micF, nepI, nfo, nfsB, ompW, pgi, poxB, pqiA, ptsG, waaY, ribA, rob, sodA, soxS, tolC, tolC, uof, ybjC, ydbK, ydbK, yrbL, zinT, zwf
Simple and complex regulons AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS
AcrR,EnvR,MarA,MprA,PhoP,Rob,SoxS
AcrR,FNR,Fur,SoxR,SoxS
AcrR,H-NS,HU,IHF,Lrp,MarA,OmpR,Rob,SoxS
ArcA,CRP,Cra,FNR,MarA,Rob,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[SoxS,+](30)
[SoxS,-](3)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  SoxS activator acnAp2 Sigma70 -51.5 -101.5 acnA
aaggtttctcCTCTTTTATCAATTTGGGTTGttatcaaatc
1335720 1335740 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [8], [9], [10]
  SoxS activator acrAp Sigma70 -72.5 -151.5 acrA, acrB
ttgcgcttctTGTTTGGTTTTTCGTGCCATatgttcgtga
485761 485780 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [9], [10], [11]
  SoxS activator acrZp Sigma70 -40.5 -62.5 acrZ
cgcaaagctgACCGCACAAAAGGGGAGTGCttttctgtgc
794701 794720 nd [CV(GEA)], [GEA], [IHBCE] [12]
  SoxS activator aldAp Sigma70 -161.0 -203.0 aldA
gcgatggaaaGTCGCTCGTTACGTTAAAAAttgcccgttt
1488019 1488038 nd [AIBSCS], [CV(GEA)], [GEA] [8]
  SoxS activator decRp Sigma70 -63.0 -94.0 decR
tttgcgttgaATTTGTCATTTTGTGCCGTGgtgtttaaac
468279 468298 nd , [IHBCE], [10]
  SoxS activator fldAp nd -61.5 -117.5 fldA, uof, fur
ttccactttcATGTAGCACAGTGTGCAGTCctgctcgttt
711573 711592 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [10], [11], [13], [14]
  SoxS activator fldBp Sigma70 -49.0 -82.0 fldB
ttatggtcacTCATTTGATCCATTATGCCTtattgtgccg
3039763 3039782 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [15]
  SoxS activator fldBp Sigma70 -38.0 -71.0 fldB
catttgatccATTATGCCTTATTGTGCCGTGactaaagcga
3039774 3039794 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [8], [15]
  SoxS activator fprp Sigma70 -56.5 -83.5 fpr
cctctgattgATTTGATCGATTGAGCCTTCcagtccttcg
4114546 4114565 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [9], [10], [11], [13], [16]
  SoxS activator fumCp Sigma38 19.5 -102.5 fumC
ggtttttttaCATGGCACGAAAGACCAAACatttgttatc
1686681 1686700 nd [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [10], [13], [16], [17], [18]
  SoxS activator inaAp Sigma70 -41.5 -68.5 inaA
attcattaatACGACACGTTTCATTAAGATtttcctcagg
2349531 2349550 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [9], [11], [13]
  SoxS activator marRp Sigma70 -61.5 -88.5 marR, marA, marB
acttgaaccgATTTAGCAAAACGTGGCATCggtcaattca
1619022 1619041 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [9], [11], [19]
  SoxS activator micFp Sigma38, Sigma70 -119.5 -119.5 micF
aagattattgCGGAATGGCGAAATAAGCACctaacatcaa
2312955 2312974 nd [BCE], [BPP], , [IHBCE], [5], [10], [20]
  SoxS activator micFp Sigma38, Sigma70 -38.5 -38.5 micF
gtatttgacaGCACTGAATGTCAAAACAAAaccttcactc
2313036 2313055 nd [BCE], [BPP], , [IHBCE], [5], [10], [20]
  SoxS activator nepIp nd 6.0 -27.0 nepI
gttaaagtggTCGGCTTTTCCCCTGAAACAtgccacgggt
3841756 3841775 nd , [IHBCE], [10]
  SoxS activator nfop Sigma70 -37.0 -71.0 nfo
caaagcgtcaTCGCATAAACCACTACATCTtgctcctgtt
2250759 2250778 nd [APIORCISFBSCS], [BCE], [CV(GEA)], [GEA] [4], [5], [11], [21]
  SoxS activator nfop Sigma70 -26.0 -60.0 nfo
cgcataaaccACTACATCTTGCTCCTGTTAacccgctatc
2250770 2250789 nd , [IHBCE], [10]
  SoxS activator nfsBp Sigma70 -43.5 -72.5 nfsB
agcggaaatcTATAGCGCATTTTTCTCGCTTaccatttctc
605487 605507 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [8], [9]
  SoxS repressor ompWp nd nd nd ompW nd nd nd [GEA] [22]
  SoxS activator pgip Sigma70, Sigma38 -39.5 -75.5 pgi
cattacgctaACGGCACTAAAACCATCACATttttctgtga
4233673 4233693 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [8], [23]
  SoxS activator poxBp Sigma38, Sigma70 -60.5 -87.5 poxB
ttcatcgggcTATTTAACCGTTAGTGCCTCctttctctcc
911127 911146 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [11]
  SoxS activator pqiAp1 Sigma70, Sigma38 -40.0 -375.0 pqiA, pqiB, pqiC
ccgcggcaaaAGCAGAAACTGTAAAACGCAgcagtagcaa
1011616 1011635 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [11], [24]
  SoxS activator ptsGp1 nd -83.5 -186.5 ptsG
ttgtgacataTGTTTTGTCAAAATGTGCAACttctccaatg
1157673 1157693 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [23]
  SoxS activator ribAp1 Sigma70 -69.0 -99.0 ribA
aggaaaaattGACAGATTTGTGCCATTCCGtgaacgatcg
1339249 1339268 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [10], [11], [25], [26]
  SoxS repressor robp nd -19.5 -62.5 rob
actgaatgctAAAACAGCAAAAAATGCTATtatccaatta
4635363 4635382 nd [APIORCISFBSCS], [BPP] [27]
  SoxS activator sodAp Sigma70 -44.0 -95.0 sodA
cccttacgaaAAGTACGGCATTGATAATCAttttcaatat
4100705 4100724 nd [APIORCISFBSCS], [BCE], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [4], [9], [10], [13], [21]
  SoxS repressor soxSp Sigma70 3.0 -38.0 soxS
gaattatactCCCCAACAGATGAATTAACGaactgaacac
4277411 4277430 nd [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [6], [10]
  SoxS activator tolCp3 nd -40.5 -93.5 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTTttgcggtagc
3178012 3178032 nd [AIBSCS], [CV(GEA)], [GEA] [28], [29], [30]
  SoxS activator tolCp4 Sigma38 -52.5 -93.5 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTTttgcggtagc
3178012 3178032 nd [AIBSCS], [CV(GEA)], [GEA] [28], [29], [30]
  SoxS activator uofp nd -61.5 -165.5 uof, fur
tacgccgtatTAATAGATAATGCCAATCAAaataattgct
710881 710900 nd [BPP], , [IHBCE], [10], [14]
  SoxS activator waaYp Sigma70 -42.5 -214.0 waaY, waaZ
gcaactaaacCGTGGCACAAATGGGCAATTtatccatcgg
3801169 3801188 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [31]
  SoxS activator ybjCp Sigma70 -56.5 -77.5 ybjC, nfsA, rimK, ybjN
ggtttaacctGTTGCATTAATTGCTAAAAGctataactgt
890826 890845 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [9], [10], [17], [32]
  SoxS activator ybjCp Sigma70 -40.5 -61.5 ybjC, nfsA, rimK, ybjN
ttaattgctaAAAGCTATAACTGTTAAACAcaatacagtg
890842 890861 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [8], [9]
  SoxS activator ydbKp nd -54.5 -101.5 ydbK, ompN
gctgatgtggGGGACACAAAAGCGAAAATGcagaagaaag
1440876 1440895 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [33]
  SoxS activator ydbKp nd -50.5 -97.5 ydbK, ompN
atgtgggggaCACAAAAGCGAAAATGCAGAagaaagccat
1440872 1440891 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [33]
  SoxS activator yrbLp nd -26.0 -57.0 yrbL
taagaggcatTGTTTAGGTTTTGTTTAAGTtaatcgacca
3348385 3348404 nd , [IHBCE], [10]
  SoxS activator zinTp Sigma70 nd nd zinT nd nd nd [GEA] [34]
  SoxS activator zwfp Sigma70 -51.5 -113.5 zwf
ttttcccgtaATCGCACGGGTGGATAAGCGtttacagttt
1936418 1936437 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [IHBCE], , [SM] [4], [9], [10], [11], [13], [21]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  SoxS activator lpxC gene -68.5
ttgggtttcgAGGCTCTTTGTGCTAAActggcccgcc
106480 106497 106488.5 [1] [10]
  SoxS activator ykgM gene 30.5
tgtcgtggaaCACCACAGTACGATACTcaggatggat
312738 312755 312746.5 [1] [10]
  SoxS activator yaiA gene -64.5
cgcagcgcccTGGCACAGACGATCAATtgttgatttt
406906 406923 406914.5 [1] [10]
  SoxS activator decR gene -94.5
tgcgttgaatTTGTCATTTTGTGCCGTggtgtttaaa
468280 468297 468288.5 [1] [10]
  SoxS activator fur gene -52.5
attagaagaaGTGACAGAATTTGCTCTtgagataatg
710690 710707 710698.5 [1] [10]
  SoxS activator fur gene -125.5
cacaagtcccTGGCAAATATTGTTAATaaaaacgtgg
710763 710780 710771.5 [1] [10]
  SoxS activator fur gene -211.5
acaggtacaaCAGCAAAAGTTACAAATttgtagcaat
710849 710866 710857.5 [1] [10]
  SoxS activator fur gene -247.5
ttattttgatTGGCATTATCTATTAATacggcgtaga
710885 710902 710893.5 [1] [10]
  SoxS activator fldA gene 59.5
aagctgttttTGAATCATTTTTGCGATattttcggta
711397 711414 711405.5 [1] [10]
  SoxS activator fldA gene -117.5
acgagcaggaCTGCACACTGTGCTACAtgaaagtgga
711574 711591 711582.5 [1] [10]
  SoxS activator acrZ gene -63.5
gcaaagctgaCCGCACAAAAGGGGAGTgcttttctgt
794701 794718 794709.5 [1] [10]
  SoxS activator ybjC gene -272.5
gtgatcccttCCGCACGAATATCTACAtactgatact
890632 890649 890640.5 [1] [10]
  SoxS activator ybjC gene -183.5
acagtaagggCAACCCGAACGACCAAAaataacggtt
890721 890738 890729.5 [1] [10]
  SoxS activator nfsA gene -349.5
gtttaacctgTTGCATTAATTGCTAAAagctataact
890826 890843 890834.5 [1] [10]
  SoxS activator ybjC gene -78.5
gtttaacctgTTGCATTAATTGCTAAAagctataact
890826 890843 890834.5 [1] [10]
  SoxS activator nfsA gene -333.5
taattgctaaAAGCTATAACTGTTAAAcacaatacag
890842 890859 890850.5 [1] [10]
  SoxS activator ybjC gene -62.5
taattgctaaAAGCTATAACTGTTAAAcacaatacag
890842 890859 890850.5 [1] [10]
  SoxS activator ltaE gene 32.5
gagcatggcgCGGCTTGGTCGGGTAACggtatcactg
909253 909270 909261.5 [1] [10]
  SoxS activator ltaE gene -279.5
acccgtaatgCCGCACGCTTCGGCAATgcgggcaaag
909565 909582 909573.5 [1] [10]
  SoxS activator poxB gene 23.5
ttcgagtgttTTGGCGATATAAGCTGCaaccgtttgt
911017 911034 911025.5 [1] [10]
  SoxS activator poxB gene -86.5
gagagaaaggAGGCACTAACGGTTAAAtagcccgatg
911127 911144 911135.5 [1] [10]
  SoxS activator mdtG gene -103.5
gcaatccagaGAGCTTTTATCGCTAAAtcagggggat
1115585 1115602 1115593.5 [1] [10]
  SoxS activator acnA gene -98.5
ttctcctcttTTATCAATTTGGGTTGTtatcaaatcg
1335724 1335741 1335732.5 [1] [10]
  SoxS activator ydbK gene -102.5
tcttctgcatTTTCGCTTTTGTGTCCCccacatcagc
1440878 1440895 1440886.5 [1] [10]
  SoxS activator ydeE gene -95.5
ccggttacgaCGGCATTAATGCGCAAAtaagtcgcta
1621228 1621245 1621236.5 [1] [10]
  SoxS activator fumC gene -102.5
taacaaatgtTTGGTCTTTCGTGCCATgtaaaaaaac
1686682 1686699 1686690.5 [1] [10]
  SoxS activator yobH gene -288.5
gatatcaccaCGGGATAAACTGGTTAAtggcacaaat
1908628 1908645 1908636.5 [1] [10]
  SoxS activator znuB gene -257.5
tatgaccttaTTGACCAACTGCGTCGTgaactggatt
1943148 1943165 1943156.5 [1] [10]
  SoxS activator znuB gene -240.5
actgcgtcgtGAACTGGATTGTGGCGTtttaatggtt
1943165 1943182 1943173.5 [1] [10]
  SoxS activator znuB gene -191.5
catctggtgaTGGCAAAAACCGATGAAgtgctgtgcc
1943214 1943231 1943222.5 [1] [10]
  SoxS activator znuB gene 46.5
agccgggatcATGCTCGCCTGTGCCGCgggtccgctg
1943452 1943469 1943460.5 [1] [10]
  SoxS activator nfo gene -73.5
caaagcgtcaTCGCATAAACCACTACAtcttgctcct
2250758 2250775 2250766.5 [1] [10]
  SoxS activator yeiI gene -145.5
gcctcggtgaAGGCAATATCGGTCATGatgcgttccg
2251546 2251563 2251554.5 [1] [10]
  SoxS activator ligA gene -63.5
gaggagttaaTTTGCCTTAAGTGTATCaggcgttggc
2530231 2530248 2530239.5 [1] [10]
  SoxS activator ligA gene -148.5
agtcatcataCGGCGCTGATCGTCAAGcacgacaccg
2530316 2530333 2530324.5 [1] [10]
  SoxS activator fldB gene -70.5
ttgatccattATGCCTTATTGTGCCGTgactaaagcg
3039776 3039793 3039784.5 [1] [10]
  SoxS repressor metK gene -267.5
taccccacaaTGGCAGAAAATTGCAAAagataaatac
3086430 3086447 3086438.5 [1] [10]
  SoxS repressor metK gene -198.5
agccacgtttTTAACAGAATGAGACACgattcaaaaa
3086499 3086516 3086507.5 [1] [10]
  SoxS repressor metK gene -187.5
taacagaatgAGACACGATTCAAAAAAaagtggaaat
3086510 3086527 3086518.5 [1] [10]
  SoxS activator yggX gene -171.5
cacttagataTTGTGCCTATGTGGCTTcccgtgtcgt
3103913 3103930 3103921.5 [1] [10]
  SoxS activator yggX gene -161.5
ttgtgcctatGTGGCTTCCCGTGTCGTcattcaccgg
3103923 3103940 3103931.5 [1] [10]
  SoxS activator mltC gene -315.5
gaacgattttTTGTACTTTCCTGCAACgtgaagcaga
3104109 3104126 3104117.5 [1] [10]
  SoxS activator yggX gene 24.5
gaacgattttTTGTACTTTCCTGCAACgtgaagcaga
3104109 3104126 3104117.5 [1] [10]
  SoxS activator mqsA gene -175.5
aatgataacaTTACACATACCATCAAAatccaaacct
3168413 3168430 3168421.5 [1] [10]
  SoxS activator yrbL gene 3.5
tttccaggagATGGCATGATTCGCTTATctgaacaaag
3348447 3348464 3348456.0 [1] [10]
  SoxS repressor dctR gene -89.5
catcaaattaATACACAGTAAGCTAACtattattatt
3654585 3654602 3654593.5 [1] [10]
  SoxS repressor dctR gene -70.5
aagctaactaTTATTATTATAAGCCCTgtcctgttaa
3654604 3654621 3654612.5 [1] [10]
  SoxS activator yhjB gene -178.5
tacatgtcgaGGGCACTATTTAAAACAattttgagga
3672064 3672081 3672072.5 [1] [10]
  SoxS activator yhjB gene -285.5
aacggcaaggAGACAAAAATAAGCACAaatagccaac
3672171 3672188 3672179.5 [1] [10]
  SoxS activator yhjB gene -295.5
agacaaaaatAAGCACAAATAGCCAACacgtcctctg
3672181 3672198 3672189.5 [1] [10]
  SoxS activator nepI gene 79.5
atcagacaggCGACACAAAACGCCACCgagaaaacgg
3841651 3841668 3841659.5 [1] [10]
  SoxS activator sodA gene -92.5
acgaaaagtaCGGCATTGATAATCATTttcaatatca
4100709 4100726 4100717.5 [1] [10]
  SoxS activator kdgT gene 18.5
tgcagataaaACGCTCGATTGAGAAAAtcccgggggg
4101700 4101717 4101708.5 [1] [10]
  SoxS activator kdgT gene 68.5
ccgctattccTTGGCGCACTGTGCCACaccttctcgc
4101750 4101767 4101758.5 [1] [10]
  SoxS activator nd tu nd
gcctaagtaaATAGCTCACTTTGTTAACAActttaactac
3303372 3303391 3303382.0 nd [AIBSCS], [GEA] [8]
  SoxS activator nd tu nd
aaaaccttcaGTGGCACGTTTGGCGAAATTcagaatgatt
189597 189616 189607.0 nd [AIBSCS], [GEA] [8]
  SoxS activator nd tu nd
cgcaaaagacTTTGCACATTTTGCTAATTTcaccgtaccg
3172452 3172471 3172462.0 nd [AIBSCS], [GEA] [8]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| paraquat 0.25 mM; glucose 0.2%| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| soxS knockout mutant| M9 minimal medium| paraquat 0.25 mM; glucose 0.2%| mid exponential phase



Alignment and PSSM for SoxS TFBSs    

Aligned TFBS of SoxS   
  Sequence
  GAATTTGTCATTTTGTGCCGTG
  ATGTTTGGTCTTTCGTGCCATG
  TTGTTTGGTTTTTCGTGCCATA
  CTATTTAACCGTTAGTGCCTCC
  TAAATTGCCCATTTGTGCCACG
  TGTTTTGACATTCAGTGCTGTC
  TGATTTGATCGATTGAGCCTTC
  GCTTTTAGCAATTAATGCAACA
  TCATTTGATCCATTATGCCTTA
  AAGGTTGGCGTTACGTGCCATA
  GCGTTTTACAGTTTCTGCTTTT
  CGATTTAGCAAAACGTGGCATC
  TGTTTTGTCAAAATGTGCAACT
  AGATGTAGTGGTTTATGCGATG
  AAATTGACAGATTTGTGCCATT
  TCTTTTATCAATTTGGGTTGTT
  GTGTTTAACAGTTATAGCTTTT
  GATAATAGCATTTTTTGCTGTT
  GCATTTTCGCTTTTGTGTCCCC
  ATTTTTAACGTAACGAGCGACT
  TCATGTAGCACAGTGTGCAGTC
  CGTATTAATAGATAATGCCAAT
  ATGTGATGGTTTTAGTGCCGTT
  AGCACTCCCCTTTTGTGCGGTC
  AATCTTAATGAAACGTGTCGTA
  ACGCTTATCCACCCGTGCGATT
  GAAAATGATTATCAATGCCGTA
  TTAATTCATCTGTTGGGGAGTA
  GTTAGGTGCTTATTTCGCCATT
  ATGTTTCAGGGGAAAAGCCGAC
  TCTATAGCGCATTTTTCTCGCT
  GCATTGTTTAGGTTTTGTTTAA

Position weight matrix (PWM). SoxS matrix-quality result   
A	10	7	13	8	2	2	13	12	1	12	10	9	6	8	6	4	0	0	4	13	3	8
C	3	9	1	2	1	0	3	5	17	10	2	1	3	7	1	1	1	25	18	1	7	8
G	9	7	8	1	4	3	11	10	4	6	8	3	1	0	20	2	31	2	4	12	0	4
T	10	9	10	21	25	27	5	5	10	4	12	19	22	17	5	25	0	5	6	6	22	12

Consensus   
;	consensus.strict             	gcattTggccttttGtGCcgtt
;	consensus.strict.rc          	AACGGCACAAAAGGCCAAATGC
;	consensus.IUPAC              	dsdttTrrymdttyGtGCcryy
;	consensus.IUPAC.rc           	RRYGGCACRAAHKRYYAAAHSH
;	consensus.regexp             	[agt][cg][agt]ttT[ag][ag][ct][ac][agt]tt[ct]GtGCc[ag][ct][ct]
;	consensus.regexp.rc          	[AG][AG][CT]GGCAC[AG]AA[ACT][GT][AG][CT][CT]AAA[ACT][CG][ACT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [IE] Inferred from experiment

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [CEUMA] ChIP-exo evidence used in manual assertion

 [CV(GEA)] cross validation(GEA)

 [GEA] Gene expression analysis

 [IHBCE] Inferred by a human based on computational evidence

 [RE] RNA-seq evidence

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [BCE] Binding of cellular extracts

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [SM] Site mutation

 [CE] ChIP-exo evidence



Reference(s)    

 [1] Amabile-Cuevas CF., Demple B., 1991, Molecular characterization of the soxRS genes of Escherichia coli: two genes control a superoxide stress regulon., Nucleic Acids Res 19(16):4479-84

 [2] Blattner FR., Burland V., Plunkett G., Sofia HJ., Daniels DL., 1993, Analysis of the Escherichia coli genome. IV. DNA sequence of the region from 89.2 to 92.8 minutes., Nucleic Acids Res 21(23):5408-17

 [3] Fawcett WP., Wolf RE., 1994, Purification of a MalE-SoxS fusion protein and identification of the control sites of Escherichia coli superoxide-inducible genes., Mol Microbiol 14(4):669-79

 [4] Fawcett WP., Wolf RE., 1995, Genetic definition of the Escherichia coli zwf "soxbox," the DNA binding site for SoxS-mediated induction of glucose 6-phosphate dehydrogenase in response to superoxide., J Bacteriol 177(7):1742-50

 [5] Li Z., Demple B., 1994, SoxS, an activator of superoxide stress genes in Escherichia coli. Purification and interaction with DNA., J Biol Chem 269(28):18371-7

 [6] Nunoshiba T., Hidalgo E., Li Z., Demple B., 1993, Negative autoregulation by the Escherichia coli SoxS protein: a dampening mechanism for the soxRS redox stress response., J Bacteriol 175(22):7492-4

 [7] Wu J., Weiss B., 1991, Two divergently transcribed genes, soxR and soxS, control a superoxide response regulon of Escherichia coli., J Bacteriol 173(9):2864-71

 [8] Martin RG., Rosner JL., 2002, Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data., Mol Microbiol 44(6):1611-24

 [9] Martin RG., Rosner JL., 2011, Promoter discrimination at class I MarA regulon promoters mediated by glutamic acid 89 of the MarA transcriptional activator of Escherichia coli., J Bacteriol 193(2):506-15

 [10] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

 [11] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [12] Hobbs EC., Yin X., Paul BJ., Astarita JL., Storz G., 2012, Conserved small protein associates with the multidrug efflux pump AcrB and differentially affects antibiotic resistance., Proc Natl Acad Sci U S A 109(41):16696-701

 [13] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [14] Zheng M., Doan B., Schneider TD., Storz G., 1999, OxyR and SoxRS regulation of fur., J Bacteriol 181(15):4639-43

 [15] Gaudu P., Weiss B., 2000, Flavodoxin mutants of Escherichia coli K-12., J Bacteriol 182(7):1788-93

 [16] Jair KW., Martin RG., Rosner JL., Fujita N., Ishihama A., Wolf RE., 1995, Purification and regulatory properties of MarA protein, a transcriptional activator of Escherichia coli multiple antibiotic and superoxide resistance promoters., J Bacteriol 177(24):7100-4

 [17] Benov L., Fridovich I., 2002, Induction of the soxRS regulon of Escherichia coli by glycolaldehyde., Arch Biochem Biophys 407(1):45-8

 [18] Park SJ., Gunsalus RP., 1995, Oxygen, iron, carbon, and superoxide control of the fumarase fumA and fumC genes of Escherichia coli: role of the arcA, fnr, and soxR gene products., J Bacteriol 177(21):6255-62

 [19] Martin RG., Jair KW., Wolf RE., Rosner JL., 1996, Autoactivation of the marRAB multiple antibiotic resistance operon by the MarA transcriptional activator in Escherichia coli., J Bacteriol 178(8):2216-23

 [20] Delihas N., Forst S., 2001, MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors., J Mol Biol 313(1):1-12

 [21] Jair KW., Fawcett WP., Fujita N., Ishihama A., Wolf RE., 1996, Ambidextrous transcriptional activation by SoxS: requirement for the C-terminal domain of the RNA polymerase alpha subunit in a subset of Escherichia coli superoxide-inducible genes., Mol Microbiol 19(2):307-17

 [22] Zhang P., Ye Z., Ye C., Zou H., Gao Z., Pan J., 2019, OmpW is positively regulated by iron via Fur, and negatively regulated by SoxS contribution to oxidative stress resistance in Escherichia coli., Microb Pathog 138:103808

 [23] Rungrassamee W., Liu X., Pomposiello PJ., 2008, Activation of glucose transport under oxidative stress in Escherichia coli., Arch Microbiol 190(1):41-9

 [24] Koh YS., Roe JH., 1996, Dual regulation of the paraquat-inducible gene pqi-5 by SoxS and RpoS in Escherichia coli., Mol Microbiol 22(1):53-61

 [25] Koh YS., Choih J., Lee JH., Roe JH., 1996, Regulation of the ribA gene encoding GTP cyclohydrolase II by the soxRS locus in Escherichia coli., Mol Gen Genet 251(5):591-8

 [26] Koh YS., Chung WH., Lee JH., Roe JH., 1999, The reversed SoxS-binding site upstream of the ribA promoter in Escherichia coli., Mol Gen Genet 261(2):374-80

 [27] Schneiders T., Levy SB., 2006, MarA mediated transcriptional repression of the rob promoter., J Biol Chem 281(15):10049-51

 [28] Aono R., Tsukagoshi N., Yamamoto M., 1998, Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12., J Bacteriol 180(4):938-44

 [29] Rodionov DA., Gelfand MS., Mironov AA., Rakhmaninova AB., 2001, Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria., J Mol Microbiol Biotechnol 3(2):319-24

 [30] Zhang A., Rosner JL., Martin RG., 2008, Transcriptional activation by MarA, SoxS and Rob of two tolC promoters using one binding site: a complex promoter configuration for tolC in Escherichia coli., Mol Microbiol 69(6):1450-5

 [31] Lee JH., Lee KL., Yeo WS., Park SJ., Roe JH., 2009, SoxRS-mediated lipopolysaccharide modification enhances resistance against multiple drugs in Escherichia coli., J Bacteriol 191(13):4441-50

 [32] Paterson ES., Boucher SE., Lambert IB., 2002, Regulation of the nfsA Gene in Escherichia coli by SoxS., J Bacteriol 184(1):51-8

 [33] Nakayama T., Yonekura S., Yonei S., Zhang-Akiyama QM., 2013, Escherichia coli pyruvate:flavodoxin oxidoreductase, YdbK - regulation of expression and biological roles in protection against oxidative stress., Genes Genet Syst 88(3):175-88

 [34] Puskarova A., Ferianc P., Kormanec J., Homerova D., Farewell A., Nystrom T., 2002, Regulation of yodA encoding a novel cadmium-induced protein in Escherichia coli., Microbiology 148(Pt 12):3801-11

 [35] Nunoshiba T., Hidalgo E., Amabile Cuevas CF., Demple B., 1992, Two-stage control of an oxidative stress regulon: the Escherichia coli SoxR protein triggers redox-inducible expression of the soxS regulatory gene., J Bacteriol 174(19):6054-60

 [36] Cohen SP., Hachler H., Levy SB., 1993, Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli., J Bacteriol 175(5):1484-92

 [37] Ariza RR., Li Z., Ringstad N., Demple B., 1995, Activation of multiple antibiotic resistance and binding of stress-inducible promoters by Escherichia coli Rob protein., J Bacteriol 177(7):1655-61

 [38] Jair KW., Yu X., Skarstad K., Thony B., Fujita N., Ishihama A., Wolf RE., 1996, Transcriptional activation of promoters of the superoxide and multiple antibiotic resistance regulons by Rob, a binding protein of the Escherichia coli origin of chromosomal replication., J Bacteriol 178(9):2507-13

 [39] Rosenberg EY., Bertenthal D., Nilles ML., Bertrand KP., Nikaido H., 2003, Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein., Mol Microbiol 48(6):1609-19

 [40] Jain K, Saini S, 2016, MarRA, SoxSR, and Rob encode a signal dependent regulatory network in Escherichia coli., Mol Biosyst, 2016 May 24

 [41] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [42] Wood TI., Griffith KL., Fawcett WP., Jair KW., Schneider TD., Wolf RE., 1999, Interdependence of the position and orientation of SoxS binding sites in the transcriptional activation of the class I subset of Escherichia coli superoxide-inducible promoters., Mol Microbiol 34(3):414-30

 [43] Kwon HJ., Bennik MH., Demple B., Ellenberger T., 2000, Crystal structure of the Escherichia coli Rob transcription factor in complex with DNA., Nat Struct Biol 7(5):424-30

 [44] Dangi B., Pelupessey P., Martin RG., Rosner JL., Louis JM., Gronenborn AM., 2001, Structure and dynamics of MarA-DNA complexes: an NMR investigation., J Mol Biol 314(1):113-27

 [45] Griffith KL., Wolf RE., 2001, Systematic mutagenesis of the DNA binding sites for SoxS in the Escherichia coli zwf and fpr promoters: identifying nucleotides required for DNA binding and transcription activation., Mol Microbiol 40(5):1141-54

 [46] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [47] Graham AI., Sanguinetti G., Bramall N., McLeod CW., Poole RK., 2012, Dynamics of a starvation-to-surfeit shift: a transcriptomic and modelling analysis of the bacterial response to zinc reveals transient behaviour of the Fur and SoxS regulators., Microbiology 158(Pt 1):284-92



RegulonDB