RegulonDB RegulonDB 10.7:Regulon Page
   

OxyR DNA-binding transcriptional dual regulator

Synonyms: OxyR
Summary:
OxyR, "oxidative stress regulator," is the transcriptional dual regulator for the expression of antioxidant genes in response to oxidative stress, in particular, elevated levels of hydrogen peroxide. The OxyR regulon includes genes involved in peroxide metabolism, redox balance, and peroxide protection by, for example, manganese uptake [23, 26, 37, 38] Moreover, OxyR activates the synthesis of the small, noncoding oxyS RNA. This allows OxyR to regulate as many as 40 additional gene products indirectly by affecting mRNA stability or translation efficiency [39] OxyR acts as a repressor for its own synthesis in both the oxidized and reduced forms [3, 6] In addition, expression of oxyR is positively regulated by cAMP-activated Crp protein during exponential growth and negatively regulated by RpoS when cells enter stationary phase [40] Based on microarray assays, a new function as regulator of S-nitrosylation (a nitrosative stress regulon) under anaerobic conditions has been determined for OxyR [4] and it is distinct from the OxyR regulon activated by oxidative stress [4] OxyR consists of 305 amino acid residues and is a member of the LysR family of bacterial transcription factors [3, 7] It is a tetramer in solution [41] OxyR consists of two domains, the N-terminal domain, carrying a helix-turn-helix motif, and the C-terminal regulatory domain.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
OxyR Functional   [APPHINH] [1], [2], [3], [4], [5], [6], [7], [8]
Evolutionary Family: LysR
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: oxyR
  Genome position: 4158490-4159407
  Length: 918 bp / 305 aa
Operon name: oxyR
TU(s) encoding the TF:
Transcription unit        Promoter
oxyR
oxyRp


Regulon       
Regulated gene(s) ahpC, ahpF, ccp, dps, dsbG, elaB, fhuF, flu, fur, gntP, gor, grxA, hcp, hcr, hemH, isrC, katG, metE, metR, mntH, nfsA, oxyR, oxyS, poxB, rimK, sufA, sufB, sufC, sufD, sufE, sufS, trxC, uof, uxuA, uxuB, ybjC, ybjN, ychF, yjjZ, zinT, znuA, znuB, znuC
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
incorporation of metal ions (6)
sulfur metabolism (6)
detoxification (4)
membrane (4)
Transcription related (3)
Read more >
Regulated operon(s) ahpCF, ccp, dps, dsbG, elaB, fhuF, fldA-uof-fur, gntP, gor, grxA, hcp-hcr-poxB-ltaE-ybjT, hemH, isrC-flu, katG, metE, metR, mntH, oxyR, oxyS, pth-ychF, sufABCDSE, trxC, uxuAB, ybjC-nfsA-rimK-ybjN, yjjZ, zinT, znuA, znuCB
First gene in the operon(s) ahpC, ahpC, dps, elaB, fhuF, isrC, gntP, gor, grxA, hcp, hcp, katG, metE, metR, mntH, oxyR, oxyS, sufA, trxC, uof, uxuA, ybjC, ychF, ccp, yjjZ, zinT, znuA, znuC, hemH, dsbG
Simple and complex regulons CRP,ExuR,OxyR,UxuR
CRP,OxyR
CRP,OxyR,UxuR
FNR,Fur,OxyR
FNR,NarL,NarP,NsrR,OxyR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[OxyR,+-](1)
[OxyR,-](7)
[OxyR,+](21)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  OxyR activator ahpCp Sigma70 -66.0 -90.0 ahpC, ahpF
tacgaaggttGTAAGGTAAAACTTATCgatttgataa
638847 638863 nd [APIORCISFBSCS], [BPP], [GEA] [9], [10], [11], [12], [13]
  OxyR activator ahpCp Sigma70 -44.0 -68.0 ahpC, ahpF
ttatcgatttGATAATGGAAACGCATTagccgaatcg
638869 638885 nd [APIORCISFBSCS], [BPP], [GEA] [9], [10], [11], [12], [13], [14]
  OxyR activator ahpCp2 Sigma70 -76.0 -328.0 ahpC, ahpF
aaagtcgagtAAAAGGCATAACCTATCactgtcatag
638609 638625 nd [APIORCISFBSCS], [BPP], [GEA] [13]
  OxyR activator ahpCp2 Sigma70 -53.0 -305.0 ahpC, ahpF
tatcactgtcATAGGTAAGAGCTTAGAtcaggtgatt
638632 638648 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [13], [15]
  OxyR activator dpsp Sigma70, Sigma38 -66.0 -105.0 dps
ttgtttttcaCGCTTGTTACCACTATTagtgtgatag
849008 849024 nd [APIORCISFBSCS] [16]
  OxyR activator dpsp Sigma70, Sigma38 -44.0 -83.0 dps
ctattagtgtGATAGGAACAGCCAGAAtagcggaaca
848986 849002 nd [APIORCISFBSCS] [16]
  OxyR activator dpsp Sigma70, Sigma38 -17.0 -56.0 dps
tagcggaacaCATAGCCGGTGCTATACttaatctcgt
848959 848975 nd , [IHBCE], [15]
  OxyR activator dsbGp nd -77.0 -304.0 dsbG
cgattcggctAATGCGTTTCCATTATCaaatcgataa
638869 638885 nd [APIORCISFBSCS], [BPP], [GEA] [10], [11], [12], [13], [14]
  OxyR activator dsbGp nd -55.0 -282.0 dsbG
ttatcaaatcGATAAGTTTTACCTTACaaccttcgta
638847 638863 nd [APIORCISFBSCS], [BPP], [GEA] [10], [11], [12], [13]
  OxyR activator elaBp Sigma38 -31.0 -57.0 elaB
cacattgggaTGGCACGCGAGGTAATTCAGGCGTAATCAACAACCCTTGTCTATAGTtagtgacagg
2381061 2381107 nd [APIORCISFBSCS], [BPP], [GEA], [SM] [17]
  OxyR repressor elaBp Sigma38 -31.0 -57.0 elaB
cacattgggaTGGCACGCGAGGTAATTCAGGCGTAATCAACAACCCTTGTCTATAGTtagtgacagg
2381061 2381107 nd [APIORCISFBSCS], [BPP], [GEA], [SM] [17]
  OxyR repressor fhuFp Sigma70 -105.0 -136.0 fhuF
gtacgttgcaACATGATTTCATCTCTTtcattgataa
4605791 4605807 nd [APIORCISFBSCS], [BPP], [GEA] [13]
  OxyR repressor fhuFp Sigma70 -83.0 -114.0 fhuF
ctctttcattGATAATGATAACCAATAtcatatgata
4605769 4605785 nd [APIORCISFBSCS], [BPP], [GEA] [13]
  OxyR repressor fhuFp Sigma70 -21.0 -52.0 fhuF
aatcccttgcTATCGGGTAAACCTATCgctatgatta
4605707 4605723 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [13], [15]
  OxyR repressor fhuFp Sigma70 2.0 -30.0 fhuF
ctatcgctatGATTAGCAATCATTATCatttagatta
4605685 4605701 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [13], [15]
  OxyR repressor flup Sigma70 -26.0 -26.0 isrC, flu
actgtctctcTTGTCCGTGCAATAGCTcaataataga
2071283 2071299 nd , [IHBCE], [15]
  OxyR repressor flup Sigma70 2.0 2.0 isrC, flu
caataatagaATAAAACGATCAATATCtattttatcg
2071310 2071326 nd [APIORCISFBSCS], [BPP], [GEA], [SM] [18], [19], [20], [21], [22]
  OxyR repressor flup Sigma70 24.0 24.0 isrC, flu
atatctatttTATCGATCGTTTATATCgatcgataag
2071332 2071348 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], , [SM] [15], [18], [19], [20], [21], [22]
  OxyR repressor gntPp Sigma70 -152.0 -190.0 gntP
cttttggtaaGACATGTCAACCCGAATtctgaaattg
4551478 4551494 nd [APIORCISFBSCS], [GEA] [23]
  OxyR repressor gntPp Sigma70 -130.0 -168.0 gntP
cgaattctgaAATTGGTTAACCACATCacaagaattt
4551456 4551472 nd [APIORCISFBSCS], [GEA] [23]
  OxyR activator gorp Sigma70, Sigma38 nd nd gor nd nd nd [GEA] [24]
  OxyR activator grxAp nd -66.0 -89.0 grxA
gtttaacagtTATAGCTTTTAGCAATTaatgcaacag
890834 890850 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [15], [23], [25]
  OxyR activator grxAp nd -44.0 -67.0 grxA
caattaatgcAACAGGTTAAACCTACTttcagcgaat
890812 890828 nd [APIORCISFBSCS], [BPP], [GEA] [23], [25]
  OxyR activator grxAp nd 8.0 -16.0 grxA
tcattacaggCATAAATCTATGAGGAGagaaataatg
890761 890777 nd , [IHBCE], [15]
  OxyR activator hcpp nd nd nd hcp, hcr, poxB nd nd nd [BPP], [GEA] [4]
  OxyR activator hemHp Sigma70 -55.0 -79.0 hemH
ctattcctttTTCTGATTTGACCTCTCacagcaatta
497968 497984 nd [BPP], [GEA] [23]
  OxyR activator hemHp Sigma70 -33.0 -57.0 hemH
ctctcacagcAATTAGTTCTTCTTCCTcacttttccg
497990 498006 nd [BPP], [GEA] [23]
  OxyR activator katGp Sigma70 -66.0 -89.0 katG
ccaacaatatGTAAGATCTCAACTATCgcatccgtgg
4133738 4133754 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [10], [11], [12], [13], [14], [15]
  OxyR activator katGp Sigma70 -44.0 -67.0 katG
ctatcgcatcCGTGGATTAATTCAATTataacttctc
4133760 4133776 nd [APIORCISFBSCS], [BPP], [GEA] [10], [11], [12], [13], [14]
  OxyR activator katGp Sigma70 2.0 -22.0 katG
tgtgtatcgtAACGGTAACACTGTAGAggggagcaca
4133805 4133821 nd , [IHBCE], [15]
  OxyR activator metEp nd -42.0 -211.0 metE
cttcacttcgGCATGAATAATTTGCGCttgaggaata
4012834 4012850 nd , [IHBCE], [15]
  OxyR activator metRp1 nd -5.0 -44.0 metR
taattggcggTTACTGTATATTCCTCAagcgcaaatt
4012852 4012868 nd , [IHBCE], [15]
  OxyR activator mntHp Sigma70, Sigma70 -76.0 -104.0 mntH
ttttcgtagtCATAATCCTGGTCTATCagagaaatca
2512802 2512818 nd [APIORCISFBSCS], , [GEA], [IHBCE], , [SM] [15], [26], [27]
  OxyR activator mntHp Sigma70, Sigma70 -54.0 -82.0 mntH
ctatcagagaAATCACCACAATCCATTtaaatgaatt
2512780 2512796 nd [AIBSCS], [GEA], [SM] [26], [27]
  OxyR repressor oxyRp Sigma38, Sigma70 -18.0 -51.0 oxyR
tgatagggatAATCGTTCATTGCTATTctacctatcg
4158431 4158447 nd [APIORCISFBSCS], [BPP], [GEA] [3], [10], [12], [28]
  OxyR repressor oxyRp Sigma38, Sigma70 5.0 -29.0 oxyR
ctattctaccTATCGCCATGAACTATCgtggcgatgg
4158453 4158469 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [3], [10], [12], [15], [28]
  OxyR activator oxySp Sigma70 -67.0 -67.0 oxyS
ccatcgccacGATAGTTCATGGCGATAggtagaatag
4158453 4158469 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [12], [15], [28]
  OxyR activator oxySp Sigma70 -45.0 -45.0 oxyS
cgataggtagAATAGCAATGAACGATTatccctatca
4158431 4158447 nd [APIORCISFBSCS], [BPP], [GEA] [12], [28]
  OxyR activator sufAp Sigma70 -232.0 -264.0 sufA, sufB, sufC, sufD, sufS, sufE
tctgaacgctGCACTTTTTTACCTATCtcttaaatag
1764642 1764658 nd [BPP], , [GEA], [IHBCE], [15], [23], [29], [30], [31], [32]
  OxyR activator sufAp Sigma70 -210.0 -242.0 sufA, sufB, sufC, sufD, sufS, sufE
ctatctcttaAATAGTCATTTTCAATAcaactttttc
1764620 1764636 nd [BPP], [GEA], [SM] [23], [29], [30], [31], [32]
  OxyR activator trxCp Sigma70 -57.0 -117.0 trxC
ccaaagcctgCGACTATCATACCTATTgaataaaaca
2718610 2718626 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [15], [33]
  OxyR activator trxCp Sigma70 -35.0 -95.0 trxC
ctattgaataAAACAGATTGTTGTCTGgaacaatgtc
2718632 2718648 nd [APIORCISFBSCS], [BPP], [GEA] [33]
  OxyR activator uofp nd -62.0 -166.0 uof, fur
acgccgtattAATAGATAATGCCAATCaaaataattg
710883 710899 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [15], [34]
  OxyR activator uofp nd -40.0 -144.0 uof, fur
caatcaaaatAATTGCTACAAATTTGTaacttttgct
710861 710877 nd [APIORCISFBSCS], [BPP], [GEA] [34]
  OxyR repressor uxuAp Sigma70 -54.0 -172.0 uxuA, uxuB
aaattcttgtGATGTGGTTAACCAATTtcagaattcg
4551456 4551472 nd [APIORCISFBSCS], [GEA] [23]
  OxyR repressor uxuAp Sigma70 -32.0 -150.0 uxuA, uxuB
caatttcagaATTCGGGTTGACATGTCttaccaaaag
4551478 4551494 nd [APIORCISFBSCS], [GEA] [23]
  OxyR repressor ybjCp Sigma70 -72.0 -93.0 ybjC, nfsA, rimK, ybjN
attcgctgaaAGTAGGTTTAACCTGTTgcattaattg
890812 890828 nd [APIORCISFBSCS], [BPP], [GEA] [23], [25]
  OxyR repressor ybjCp Sigma70 -50.0 -71.0 ybjC, nfsA, rimK, ybjN
ctgttgcattAATTGCTAAAAGCTATAactgttaaac
890834 890850 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [15], [23], [25]
  OxyR repressor ychFp Sigma70 9.5 -61.5 ychF
aataggcaaaGTTATTTCCATTTCTGCaatctgttag
1257865 1257881 nd [APIORCISFBSCS], [BPP] [35]
  OxyR repressor ychFp Sigma70 31.5 -39.5 ychF
tctgcaatctGTTAGCAATAACAGGTTgattattaag
1257843 1257859 nd [APIORCISFBSCS], [BPP] [35]
  OxyR activator yhjAp Sigma70 -86.0 -159.0 ccp
tgatctgggtAATAGGCACAGGCTATCttattgatag
3669339 3669355 nd [AIBSCS], [BPP], , [IHBCE], [15], [36]
  OxyR activator yhjAp Sigma70 -64.0 -137.0 ccp
ctatcttattGATAGTTTATATTCATGtaattgattg
3669317 3669333 nd [APIORCISFBSCS], [BPP] [36]
  OxyR activator yjjZp Sigma70 -62.0 -89.0 yjjZ
taatcatagcGATAGGTTTACCCGATAgcaagggatt
4605707 4605723 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [13], [15]
  OxyR activator zinTp Sigma70 21.5 -8.5 zinT
tatacattaaCTCTGGAGGAAACTGTTttggcgattc
2041358 2041374 nd , [IHBCE], [15]
  OxyR activator znuAp Sigma38 55.5 -23.5 znuA
atatcacactTCTCATATTCATTACGAttattggtcg
1942598 1942614 nd , [IHBCE], [15]
  OxyR activator znuCp Sigma70 -27.5 -55.5 znuC, znuB
cgaccaataaTCGTAATGAATATGAGAagtgtgatat
1942598 1942614 nd , [IHBCE], [15]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  OxyR activator sufB gene -1453.0 1763975 1763994 [1] nd [15]
  OxyR activator mntH gene -1336.0 2512804 2512823 [1] nd [15]
  OxyR activator mntH gene -1314.0 2512782 2512801 [1] nd [15]
  OxyR activator mntH gene -1138.0 2512606 2512625 [1] nd [15]
  OxyR activator dps gene -644.0 849052 849071 [1] nd [15]
  OxyR activator dps gene -580.0 848988 849007 [1] nd [15]
  OxyR activator grxA gene -346.0 890842 890861 [1] nd [15]
  OxyR activator grxA gene -340.0 890836 890855 [1] nd [15]
  OxyR activator grxA gene -318.0 890814 890833 [1] nd [15]
  OxyR activator grxA gene -247.0 890743 890762 [1] nd [15]
  OxyR activator dps gene -134.0 849045 849064 [1] nd [15]
  OxyR activator dps gene -92.0 849003 849022 [1] nd [15]
  OxyR activator grxA gene -92.0 890845 890864 [1] nd [15]
  OxyR activator grxA gene -76.0 890829 890848 [1] nd [15]
  OxyR activator sufA gene -42.0 1764428 1764447 [1] nd [15]
  OxyR activator metR gene 10.0 4012806 4012825 [1] nd [15]
  OxyR activator yjjZ gene 33.0 4605771 4605790 [1] nd [15]
  OxyR activator oxyR gene 35.0 4158455 4158474 [1] nd [15]
  OxyR activator yjjZ gene 39.0 4605765 4605784 [1] nd [15]
  OxyR activator ahpC gene 96.0 638849 638868 [1] nd [15]
  OxyR activator trxC gene 123.0 2718612 2718631 [1] nd [15]
  OxyR activator trxC gene 132.0 2718603 2718622 [1] nd [15]
  OxyR activator yjjZ gene 254.0 4605786 4605805 [1] nd [15]
  OxyR activator ahpC gene 334.0 638611 638630 [1] nd [15]
  OxyR activator yjjZ gene 338.0 4605702 4605721 [1] nd [15]
  OxyR activator yjjZ gene 616.0 4605424 4605443 [1] nd [15]
  OxyR activator ahpC gene 875.0 638633 638652 [1] nd [15]
  OxyR activator ahpC gene 882.0 638626 638645 [1] nd [15]
  OxyR activator oxyR gene 981.0 4158426 4158445 [1] nd [15]
  OxyR activator oxyR gene 990.0 4158417 4158436 [1] nd [15]
  OxyR activator ahpF gene 1524.0 639794 639813 [1] nd [15]
  OxyR activator metE gene 2508.0 4012806 4012825 [1] nd [15]
  OxyR repressor ribB gene -968.0 3184781 3184800 [1] nd [15]
  OxyR repressor ybjC gene 71.0 890842 890861 [1] nd [15]
  OxyR repressor ybjC gene 77.0 890836 890855 [1] nd [15]
  OxyR repressor ybjC gene 99.0 890814 890833 [1] nd [15]
  OxyR repressor ybjC gene 170.0 890743 890762 [1] nd [15]
  OxyR repressor flu gene 201.0 2071338 2071357 [1] nd [15]
  OxyR repressor flu gene 214.0 2071325 2071344 [1] nd [15]
  OxyR repressor flu gene 233.0 2071306 2071325 [1] nd [15]
  OxyR repressor fimB gene 279.0 4540678 4540697 [1] nd [15]
  OxyR repressor ybjC gene 355.0 890845 890864 [1] nd [15]
  OxyR repressor ybjC gene 371.0 890829 890848 [1] nd [15]
  OxyR repressor yidD gene 603.0 3884470 3884489 [1] nd [15]
  OxyR repressor mdtK gene 1298.0 1743532 1743551 [1] nd [15]
  OxyR repressor crfC gene 2313.0 4327050 4327069 [1] nd [15]
  OxyR repressor flu gene 3327.0 2071331 2071350 [1] nd [15]
  OxyR repressor flu gene 3359.0 2071299 2071318 [1] nd [15]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| paraquat 0.25 mM; glucose 0.2%| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| oxyR knockout mutant| M9 minimal medium| paraquat 0.25 mM; glucose 0.2%| mid exponential phase



Alignment and PSSM for OxyR TFBSs    

Aligned TFBS of OxyR   
  Sequence
  AAAGGCATAACCTATCACTG
  ATCGGGTAAACCTATCGCTA
  GTAGGTTTAACCTGTTGCAT
  ATTGCTAAAAGCTATAACTG
  ATTGGCATTATCTATTAATA
  ATTGGTTATCATTATCAATG
  TAAGCTCTTACCTATGACAG
  TAAGGTAAAACTTATCGATT
  TAAGATCTCAACTATCGCAT
  ATCGATATAAACGATCGATA
  ATCGCCATGAACTATCGTGG
  ATAGAATAAAACGATCAATA
  ATGAATATAAACTATCAATA
  ATAGCCTGTGCCTATTACCC
  TCTGATTTGACCTCTCACAG
  TCTGGCTGTTCCTATCACAC
  ATTGAAAATGACTATTTAAG
  ATGTGGTTAACCAATTTCAG
  ATAGCAATGAACGATTATCC
  GCTTGTTACCACTATTAGTG
  ATTAGCAATCATTATCATTT
  ATAGACCAGGATTATGACTA
  ATGCGTTTCCATTATCAAAT
  TTCGGCATGAATAATTTGCG
  CACTTTTTTACCTATCTCTT
  GACTATCATACCTATTGAAT
  CATGATTTCATCTCTTTCAT
  ATGGATTGTGGTGATTTCTC
  TTCGGGTTGACATGTCTTAC
  GTGGATTAATTCAATTATAA
  TTAGCAATAACAGGTTGATT
  CAGGCATAAATCTATGAGGA
  TCTGGAGGAAACTGTTTTGG
  GGAAGAAGAACTAATTGCTG
  AATCGTAATGAATATGAGAA
  TGAGGAATATACAGTAACCG
  GTTCCAGACAACAATCTGTT
  CAAAGTTATTTCCATTTCTG
  TAACGGTAACACTGTAGAGG
  CAAATTTGTAGCAATTATTT
  TATAGCACCGGCTATGTGTT
  TCTTGTCCGTGCAATAGCTC

Position weight matrix (PWM). OxyR matrix-quality result   
A	18	13	15	6	11	9	16	16	16	26	18	3	8	34	0	4	20	11	13	9
C	5	5	7	4	8	9	5	2	6	5	14	31	1	2	0	16	0	18	4	6
G	6	2	6	27	21	4	2	6	7	6	5	0	5	6	0	5	11	6	4	15
T	13	22	14	5	2	20	19	18	13	5	5	8	28	0	42	17	11	7	21	12

Consensus   
;	consensus.strict             	ataGgtttaacCtATcactg
;	consensus.strict.rc          	CAGTGATAGGTTAAACCTAT
;	consensus.IUPAC              	wwwGgywwwamCtATyrcwg
;	consensus.IUPAC.rc           	CWGYRATAGKTWWWRCCWWW
;	consensus.regexp             	[at][at][at]Gg[ct][at][at][at]a[ac]CtAT[ct][ag]c[at]g
;	consensus.regexp.rc          	C[AT]G[CT][AG]ATAG[GT]T[AT][AT][AT][AG]CC[AT][AT][AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [APPHINH] Assay of protein purified to homogeneity from its native host

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [CEUMA] ChIP-seq evidence used in manual assertion

 [IHBCE] Inferred by a human based on computational evidence

 [RE] RNA-seq evidence

 [SM] Site mutation

 [AIBSCS] Automated inference based on similarity to consensus sequences



Reference(s)    

 [1] Blattner FR., Burland V., Plunkett G., Sofia HJ., Daniels DL., 1993, Analysis of the Escherichia coli genome. IV. DNA sequence of the region from 89.2 to 92.8 minutes., Nucleic Acids Res 21(23):5408-17

 [2] Bolker M., Kahmann R., 1989, The Escherichia coli regulatory protein OxyR discriminates between methylated and unmethylated states of the phage Mu mom promoter., EMBO J 8(8):2403-10

 [3] Christman MF., Storz G., Ames BN., 1989, OxyR, a positive regulator of hydrogen peroxide-inducible genes in Escherichia coli and Salmonella typhimurium, is homologous to a family of bacterial regulatory proteins., Proc Natl Acad Sci U S A 86(10):3484-8

 [4] Seth D., Hausladen A., Wang YJ., Stamler JS., 2012, Endogenous protein S-Nitrosylation in E. coli: regulation by OxyR., Science 336(6080):470-3

 [5] Tao K., Fujita N., Ishihama A., 1993, Involvement of the RNA polymerase alpha subunit C-terminal region in co-operative interaction and transcriptional activation with OxyR protein., Mol Microbiol 7(6):859-64

 [6] Tao K., Makino K., Yonei S., Nakata A., Shinagawa H., 1991, Purification and characterization of the Escherichia coli OxyR protein, the positive regulator for a hydrogen peroxide-inducible regulon., J Biochem 109(2):262-6

 [7] Tao K., Makino K., Yonei S., Nakata A., Shinagawa H., 1989, Molecular cloning and nucleotide sequencing of oxyR, the positive regulatory gene of a regulon for an adaptive response to oxidative stress in Escherichia coli: homologies between OxyR protein and a family of bacterial activator proteins., Mol Gen Genet 218(3):371-6

 [8] Warne SR., Varley JM., Boulnois GJ., Norton MG., 1990, Identification and characterization of a gene that controls colony morphology and auto-aggregation in Escherichia coli K12., J Gen Microbiol 136(3):455-62

 [9] Campos E., Montella C., Garces F., Baldoma L., Aguilar J., Badia J., 2007, Aerobic L-ascorbate metabolism and associated oxidative stress in Escherichia coli., Microbiology 153(Pt 10):3399-408

 [10] Tartaglia LA., Gimeno CJ., Storz G., Ames BN., 1992, Multidegenerate DNA recognition by the OxyR transcriptional regulator., J Biol Chem 267(3):2038-45

 [11] Tartaglia LA., Storz G., Ames BN., 1989, Identification and molecular analysis of oxyR-regulated promoters important for the bacterial adaptation to oxidative stress., J Mol Biol 210(4):709-19

 [12] Toledano MB., Kullik I., Trinh F., Baird PT., Schneider TD., Storz G., 1994, Redox-dependent shift of OxyR-DNA contacts along an extended DNA-binding site: a mechanism for differential promoter selection., Cell 78(5):897-909

 [13] Zheng M., Wang X., Doan B., Lewis KA., Schneider TD., Storz G., 2001, Computation-directed identification of OxyR DNA binding sites in Escherichia coli., J Bacteriol 183(15):4571-9

 [14] Storz G., Tartaglia LA., Ames BN., 1990, Transcriptional regulator of oxidative stress-inducible genes: direct activation by oxidation., Science 248(4952):189-94

 [15] Seo SW., Kim D., Szubin R., Palsson BO., 2015, Genome-wide Reconstruction of OxyR and SoxRS Transcriptional Regulatory Networks under Oxidative Stress in Escherichia coli K-12 MG1655., Cell Rep 12(8):1289-99

 [16] Altuvia S., Almiron M., Huisman G., Kolter R., Storz G., 1994, The dps promoter is activated by OxyR during growth and by IHF and sigma S in stationary phase., Mol Microbiol 13(2):265-72

 [17] Guo Y., Li Y., Zhan W., Wood TK., Wang X., 2019, Resistance to oxidative stress by inner membrane protein ElaB is regulated by OxyR and RpoS., Microb Biotechnol 12(2):392-404

 [18] Haagmans W., van der Woude M., 2000, Phase variation of Ag43 in Escherichia coli: Dam-dependent methylation abrogates OxyR binding and OxyR-mediated repression of transcription., Mol Microbiol 35(4):877-87

 [19] Henderson IR., Owen P., 1999, The major phase-variable outer membrane protein of Escherichia coli structurally resembles the immunoglobulin A1 protease class of exported protein and is regulated by a novel mechanism involving Dam and oxyR., J Bacteriol 181(7):2132-41

 [20] Waldron DE., Owen P., Dorman CJ., 2002, Competitive interaction of the OxyR DNA-binding protein and the Dam methylase at the antigen 43 gene regulatory region in Escherichia coli., Mol Microbiol 44(2):509-20

 [21] Wallecha A., Correnti J., Munster V., van der Woude M., 2003, Phase variation of Ag43 is independent of the oxidation state of OxyR., J Bacteriol 185(7):2203-9

 [22] Wallecha A., Munster V., Correnti J., Chan T., van der Woude M., 2002, Dam- and OxyR-dependent phase variation of agn43: essential elements and evidence for a new role of DNA methylation., J Bacteriol 184(12):3338-47

 [23] Zheng M., Wang X., Templeton LJ., Smulski DR., LaRossa RA., Storz G., 2001, DNA microarray-mediated transcriptional profiling of the Escherichia coli response to hydrogen peroxide., J Bacteriol 183(15):4562-70

 [24] Becker-Hapak M., Eisenstark A., 1995, Role of rpoS in the regulation of glutathione oxidoreductase (gor) in Escherichia coli., FEMS Microbiol Lett 134(1):39-44

 [25] Tao K., 1997, oxyR-dependent induction of Escherichia coli grx gene expression by peroxide stress., J Bacteriol 179(18):5967-70

 [26] Anjem A., Varghese S., Imlay JA., 2009, Manganese import is a key element of the OxyR response to hydrogen peroxide in Escherichia coli., Mol Microbiol 72(4):844-58

 [27] Kehres DG., Janakiraman A., Slauch JM., Maguire ME., 2002, Regulation of Salmonella enterica serovar Typhimurium mntH transcription by H(2)O(2), Fe(2+), and Mn(2+)., J Bacteriol 184(12):3151-8

 [28] Kullik I., Toledano MB., Tartaglia LA., Storz G., 1995, Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for oxidation and transcriptional activation., J Bacteriol 177(5):1275-84

 [29] Jang S., Imlay JA., 2010, Hydrogen peroxide inactivates the Escherichia coli Isc iron-sulphur assembly system, and OxyR induces the Suf system to compensate., Mol Microbiol 78(6):1448-67

 [30] Lee JH., Yeo WS., Roe JH., 2004, Induction of the sufA operon encoding Fe-S assembly proteins by superoxide generators and hydrogen peroxide: involvement of OxyR, IHF and an unidentified oxidant-responsive factor., Mol Microbiol 51(6):1745-55

 [31] Outten FW., Djaman O., Storz G., 2004, A suf operon requirement for Fe-S cluster assembly during iron starvation in Escherichia coli., Mol Microbiol 52(3):861-72

 [32] Yeo WS., Lee JH., Lee KC., Roe JH., 2006, IscR acts as an activator in response to oxidative stress for the suf operon encoding Fe-S assembly proteins., Mol Microbiol 61(1):206-18

 [33] Ritz D., Patel H., Doan B., Zheng M., Aslund F., Storz G., Beckwith J., 2000, Thioredoxin 2 is involved in the oxidative stress response in Escherichia coli., J Biol Chem 275(4):2505-12

 [34] Zheng M., Doan B., Schneider TD., Storz G., 1999, OxyR and SoxRS regulation of fur., J Bacteriol 181(15):4639-43

 [35] Wenk M., Ba Q., Erichsen V., Macinnes K., Wiese H., Warscheid B., Koch HG., 2012, A Universally Conserved ATPase Regulates the Oxidative Stress Response in Escherichia coli., J Biol Chem 287(52):43585-98

 [36] Partridge JD., Poole RK., Green J., 2007, The Escherichia coli yhjA gene, encoding a predicted cytochrome c peroxidase, is regulated by FNR and OxyR., Microbiology 153(Pt 5):1499-509

 [37] Storz G, Tartaglia LA, Ames BN, 1990, The OxyR regulon., Antonie Van Leeuwenhoek, 1990 Oct

 [38] Mongkolsuk S, Helmann JD, 2002, Regulation of inducible peroxide stress responses., Mol Microbiol, 2002 Jul

 [39] Altuvia S., Weinstein-Fischer D., Zhang A., Postow L., Storz G., 1997, A small, stable RNA induced by oxidative stress: role as a pleiotropic regulator and antimutator., Cell 90(1):43-53

 [40] Gonzalez-Flecha B., Demple B., 1997, Transcriptional regulation of the Escherichia coli oxyR gene as a function of cell growth., J Bacteriol 179(19):6181-6

 [41] Kullik I, Stevens J, Toledano MB, Storz G, 1995, Mutational analysis of the redox-sensitive transcriptional regulator OxyR: regions important for DNA binding and multimerization., J Bacteriol, 1995 Mar

 [42] Lee C, Lee SM, Mukhopadhyay P, Kim SJ, Lee SC, Ahn WS, Yu MH, Storz G, Ryu SE, 2004, Redox regulation of OxyR requires specific disulfide bond formation involving a rapid kinetic reaction path., Nat Struct Mol Biol, 2004 Dec

 [43] Zaim J, Kierzek AM, 2003, The structure of full-length LysR-type transcriptional regulators. Modeling of the full-length OxyR transcription factor dimer., Nucleic Acids Res, 2003 Mar 1

 [44] Li X, Imlay JA, 2018, Improved measurements of scant hydrogen peroxide enable experiments that define its threshold of toxicity for Escherichia coli., Free Radic Biol Med, 2018 May 20

 [45] Zheng M, Aslund F, Storz G, 1998, Activation of the OxyR transcription factor by reversible disulfide bond formation., Science, 1998 Mar 13

 [46] Aslund F, Zheng M, Beckwith J, Storz G, 1999, Regulation of the OxyR transcription factor by hydrogen peroxide and the cellular thiol-disulfide status., Proc Natl Acad Sci U S A, 1999 May 25

 [47] Hausladen A, Privalle CT, Keng T, DeAngelo J, Stamler JS, 1996, Nitrosative stress: activation of the transcription factor OxyR., Cell, 1996 Sep 6

 [48] Choi H, Kim S, Mukhopadhyay P, Cho S, Woo J, Storz G, Ryu SE, 2001, Structural basis of the redox switch in the OxyR transcription factor., Cell, 2001 Apr 6

 [49] Hou N, Yan Z, Fan K, Li H, Zhao R, Xia Y, Xun L, Liu H, 2019, OxyR senses sulfane sulfur and activates the genes for its removal in Escherichia coli., Redox Biol, 2019 Sep

 [50] Knapp GS, Hu JC, 2010, Specificity of the E. coli LysR-type transcriptional regulators., PLoS One, 2010 Dec 20

 [51] Muraoka S, Okumura R, Ogawa N, Nonaka T, Miyashita K, Senda T, 2003, Crystal structure of a full-length LysR-type transcriptional regulator, CbnR: unusual combination of two subunit forms and molecular bases for causing and changing DNA bend., J Mol Biol, 2003 May 2

 [52] Gusarov I, Nudler E, 2012, S-nitrosylation signaling in Escherichia coli., Sci Signal, 2012 Jun 12

 [53] Tao K, Zou C, Fujita N, Ishihama A, 1995, Mapping of the OxyR protein contact site in the C-terminal region of RNA polymerase alpha subunit., J Bacteriol, 1995 Dec

 [54] Chiang SM, Schellhorn HE, 2012, Regulators of oxidative stress response genes in Escherichia coli and their functional conservation in bacteria., Arch Biochem Biophys, 2012 Sep 15



RegulonDB