RegulonDB RegulonDB 10.6.3:Regulon Page
   

PhoB DNA-binding transcriptional dual regulator

Synonyms: PhoB-Phosphorylated, PhoB
Summary:
PhoB is a dual transcription regulator that activates expression of the Pho regulon in response to environmental Pi. The Pho regulon includes operons and genes whose products are involved in phosphorus uptake and metabolism [3, 20, 21] Expression of the periplasmic binding proteins for peptide transport, OppA and DppA, is repressed by PhoB [22] In a proteomic analysis under phosphate-limiting conditions, it was found that up to 400 proteins are differentially expressed [21] PhoB is also involved in bacterial virulence of pathogenic Escherichia coli [23] PhoB is a response regulator and belongs to the two-component system PhoR/PhoB. Under phosphate-limited conditions, the inner membrane sensor kinase PhoR autophosphorylates. Subsequent transfer of the phosphate group to PhoB results in activation of PhoB [24] When phosphate is in excess, autophosphorylation of PhoR is inhibited and PhoB-P is dephosphorylated.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
PhoB Non-Functional   Apo [BPP] [1]
PhoB-Phosphorylated Functional Covalent Holo [BPP], [IPI] [1]
Evolutionary Family: OmpR
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: phoB
  Genome position: 417142-417831
  Length: 690 bp / 229 aa
Operon name: phoBR
TU(s) encoding the TF:
Transcription unit        Promoter
phoBR
phoBp


Regulon       
Regulated gene(s) adiC, amn, argP, asr, cra, cusA, cusB, cusC, cusF, cusR, cusS, eda, feaR, gadW, gadX, mipA, ompF, phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP, phoA, phoB, phoE, phoH, phoQ, phoR, phoU, pitB, prpR, psiE, psiF, pstA, pstB, pstC, pstS, sbcC, sbcD, tktB, ugpA, ugpB, ugpC, ugpE, ugpQ, waaH, ydfH, yedX, yegH, yhjC, ytfK
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
phosphorous metabolism (24)
membrane (12)
Transcription related (11)
activator (8)
repressor (7)
Read more >
Regulated operon(s) adiC, amn, argP, asr, cra, cusCFBA, cusRS, edd-eda, feaR, gadAXW, mipA, ompF, phnCDEFGHIJKLMNOP, phoA-psiF, phoBR, phoE, phoH, phoPQ, pitB, prpR, psiE, pstSCAB-phoU, sbcDC, talA-tktB, ugpBAECQ, waaH, ydfH, yedX, yegH, yhjC, ytfK
First gene in the operon(s) amn, argP, asr, cusC, cusR, eda, feaR, gadX, gadX, ompF, phnC, phoA, phoB, phoE, phoH, phoU, pitB, prpR, psiE, pstS, pstS, pstS, tktB, ugpB, ugpB, yegH, waaH, ytfK, cra, sbcD, ydfH, mipA, yedX, yhjC, adiC, phoQ
Simple and complex regulons ArgP,PhoB
AscG,CRP,PhoB,PrpR
CRP,CpxR,EnvY,Fur,IHF,OmpR,PhoB,RstA
CRP,Nac,NsrR,PhoB,QseB
CRP,PhoB
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[PhoB,-](7)
[PhoB,+](26)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  PhoB-Phosphorylated activator adiCp7 Sigma32 nd nd adiC nd nd [GEA] [2]
  PhoB-Phosphorylated activator amnp1 nd -33.0 -63.0 amn
cgatcttcgcCTTACACTTTTGTTTCACAtttctgtgac
2054989 2055007 [AIBSCS], [GEA] [3]
  PhoB-Phosphorylated activator argPp nd -27.0 -50.0 argP
tatatgcaacCTGACACAAAATTGTGTCAtagtgcagga
3059694 3059712 [GEA], [HIBSCS] [4]
  PhoB-Phosphorylated activator asrp Sigma38, Sigma70 -30.0 -79.0 asr
aaaccaaccaCTCACGGAAGTCTGCCATTcccagggata
1671288 1671306 [BCE], [GEA], [HIBSCS] [5]
  PhoB-Phosphorylated activator cusCp Sigma70 -54.0 -81.0 cusC, cusF, cusB, cusA
cttattggcaAAATGACAATTTTGTCATTtttctgtcac
595510 595528 [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator cusRp Sigma70 -57.0 -76.0 cusR, cusS
gtgacagaaaAATGACAAAATTGTCATTTtgccaataag
595510 595528 [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated repressor edap3 nd -53.0 -81.5 eda
ttattcagcgCCTTGCGTGAAAAACTGTCCGGtgccgaacag
1932827 1932848 [BPP], [GEA], [HIBSCS] [7]
  PhoB-Phosphorylated repressor feaRp2 Sigma70 -17.0 -43.0 feaR
gcttcgtttaTTGCAACACAAATGCAACAataaaaatac
1447317 1447335 [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated repressor fruRp8 Sigma32 nd nd cra nd nd [GEA] [2]
  PhoB-Phosphorylated activator gadXp Sigma38 nd nd gadX, gadW nd nd [GEA] [2]
  PhoB-Phosphorylated activator mipAp nd -146.5 -181.0 mipA
catccataaaTTTTGCATAATTAATGTAAAGaccaggctcg
1866643 1866663 [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator ompFp Sigma38, Sigma70 nd nd ompF nd nd [GEA] [2]
  PhoB-Phosphorylated activator phnCp Sigma70 nd nd phnC, phnD, phnE, phnF, phnG, phnH, phnI, phnJ, phnK, phnL, phnM, phnN, phnO, phnP nd nd [BPP], [GEA], [HIBSCS] [2], [8], [9]
  PhoB-Phosphorylated activator phoAp Sigma70 -31.0 -71.0 phoA, psiF
ttttcaacagCTGTCATAAAGTTGTCACGgccgagactt
401667 401685 [BCE], [GEA], [SM] [2], [10]
  PhoB-Phosphorylated activator phoBp Sigma70 -31.0 -72.0 phoB, phoR
tgcgacgagcTTTTCATAAATCTGTCATAaatctgacgc
417061 417079 [BPP], [GEA], [HIBSCS] [2], [6], [10]
  PhoB-Phosphorylated activator phoEp Sigma70 -113.0 -171.0 phoE
ttttgttgcgCGGGATCAGCAAGCCTAGCGGcagttgttta
260261 260281 [BCE], [GEA], [SM] [2], [11]
  PhoB-Phosphorylated activator phoEp Sigma70 -88.0 -146.0 phoE
agcggcagttGTTTACGCTTTTATTACAGatttaataaa
260237 260255 [BCE], [GEA], [SM] [2], [11]
  PhoB-Phosphorylated activator phoEp Sigma70 -32.0 -90.0 phoE
tattattaatCTGTAATATATCTTTAACAatctcaggtt
260181 260199 [BCE], [GEA], [SM] [2], [11]
  PhoB-Phosphorylated activator phoHp1 Sigma70 -31.0 -158.0 phoH
tttttcatcaCTGTCATCACTCTGTCATCtttccagtag
1084825 1084843 [BPP], [GEA], [HIBSCS] [2], [12]
  PhoB-Phosphorylated activator phoQp5 Sigma24 nd nd phoQ nd nd [GEA] [2]
  PhoB-Phosphorylated activator phoUp Sigma70 nd nd phoU nd nd [GEA] [2]
  PhoB-Phosphorylated repressor pitBp Sigma70 nd nd pitB nd nd [IMP] [13]
  PhoB-Phosphorylated repressor prpRp Sigma70 -24.0 -52.0 prpR
ccgcgtttcaTTGCAACAATTATGAAACAagactaaacc
348486 348504 [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator psiEp Sigma70 -53.0 -78.0 psiE
ccaaatccagGTTGAACAAAACATACACAaaaaatatag
4240238 4240256 [BPP], [GEA], [HIBSCS] [14]
  PhoB-Phosphorylated activator psiEp Sigma70 -31.0 -56.0 psiE
atacacaaaaAATATAGATCTCCGTCACAtttttgcgtt
4240260 4240278 [BPP], [GEA], [HIBSCS] [14]
  PhoB-Phosphorylated activator pstSp Sigma70, Sigma38 -54.0 -97.0 pstS, pstC, pstA, pstB, phoU
ctttatctctCTGTCATAAAACTGTCATAttccttacat
3911613 3911631 [BCE], [GEA], [HIBSCS], [SM] [2], [15], [16]
  PhoB-Phosphorylated activator pstSp Sigma70, Sigma38 -32.0 -75.0 pstS, pstC, pstA, pstB, phoU
tgtcatattcCTTACATATAACTGTCACCtgtttgtcct
3911591 3911609 [BCE], [GEA], [HIBSCS], [SM] [2], [15], [16], [17]
  PhoB-Phosphorylated repressor sbcDp Sigma70 -93.0 -118.0 sbcD, sbcC
gcgtcagattTATGACAGATTTATGAAAAgctcgtcgca
417061 417079 [BPP], [GEA], [HIBSCS] [2], [6], [10]
  PhoB-Phosphorylated activator tktBp Sigma38 nd nd tktB nd nd [GEA] [2]
  PhoB-Phosphorylated activator ugpBp1 Sigma70 -52.0 -105.0 ugpB, ugpA, ugpE, ugpC, ugpQ
tgacaccttaCTATCTTACAAATGTAACAaaaaagttat
3592421 3592439 [BPP], [GEA], [HIBSCS] [2], [18]
  PhoB-Phosphorylated activator ugpBp1 Sigma70 -30.0 -83.0 ugpB, ugpA, ugpE, ugpC, ugpQ
tgtaacaaaaAAGTTATTTTTCTGTAATTcgagcatgtc
3592399 3592417 [BPP], [GEA], [HIBSCS] [2], [18]
  PhoB-Phosphorylated repressor ugpBp2 Sigma70 -26.0 -127.0 ugpB, ugpA, ugpE, ugpC, ugpQ
cgtcaccgccTTGTCATCTTTCTGACACCttactatctt
3592443 3592461 [BPP], [HIBSCS] [18]
  PhoB-Phosphorylated repressor ugpBp2 Sigma70 -4.0 -105.0 ugpB, ugpA, ugpE, ugpC, ugpQ
tgacaccttaCTATCTTACAAATGTAACAaaaaagttat
3592421 3592439 [BPP], [GEA], [HIBSCS] [2], [18]
  PhoB-Phosphorylated activator ydfHp nd -20.0 -46.0 ydfH
gggttattgcTTGTCACAAAAAAGTGGTAgactcatgca
1628297 1628315 [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator yedXp Sigma70 nd nd yedX nd nd [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator yegHp nd nd nd yegH nd nd [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator yhjCp Sigma54 nd nd yhjC nd nd [BPP], [GEA], [HIBSCS] [6]
  PhoB-Phosphorylated activator yibDp1 Sigma70 -113.0 -181.5 waaH
ctgaggataaTCTGTTAAATATGTAAAATCCTGTCAGTgtaataaaga
3790249 3790276 [AIBSCS], [GEA] [3]
  PhoB-Phosphorylated activator yibDp1 Sigma70 -59.5 -128.0 waaH
tgtgctgatcTCTTATATAGCTGCTCTCATTatctctctac
3790199 3790219 [AIBSCS], [GEA] [3]
  PhoB-Phosphorylated activator ytfKp Sigma38 -58.0 -134.0 ytfK
ttctgaataaTTGTAACCTTTAGGTAAAAaaagttatac
4439444 4439462 [GEA], [HIBSCS] [3], [19]
  PhoB-Phosphorylated activator ytfKp Sigma38 -36.0 -112.0 ytfK
ggtaaaaaaaGTTATACGCGGTGGAAACAttgcccggat
4439466 4439484 [GEA], [HIBSCS] [3], [19]


Alignment and PSSM for PhoB TFBSs    

Aligned TFBS of PhoB   
  Sequence
  ATATGACAGTTTTATGACAG
  TTATGACAGATTTATGAAAA
  CCGTGACAACTTTATGACAG
  AGGTGACAGTTATATGTAAG
  ATGACACAATTTTGTGTCAG
  CCTTGTCATCTTTCTGACAC
  TTGTTAAAGATATATTACAG
  TTGTTGCATTTGTGTTGCAA
  TTGTTACATTTGTAAGATAG
  AGATGACAGAGTGATGACAG
  GCCTTACACTTTTGTTTCAC
  TTGTTTCATAATTGTTGCAA
  TGTTTACGCTTTTATTACAG
  GAATGGCAGACTTCCGTGAG
  ATTTTACATATTTAACAGAT
  CTACCACTTTTTTGTGACAA
  TTGTGTATGTTTTGTTCAAC
  AAAAGTTATTTTTCTGTAAT
  AATTGTAACCTTTAGGTAAA
  AAATGACAATTTTGTCATTT
  AAAATATAGATCTCCGTCAC
  ATTTTGCATAATTAATGTAA
  TGAGAGCAGCTATATAAGAG
  ATCAGCAAGCCTAGCGGCAG
  ACCGGACAGTTTTTCACGCA
  ATGTTTCCACCGCGTATAAC

Position weight matrix (PWM). PhoB matrix-quality result   
A	13	5	9	4	1	15	4	22	4	8	2	3	1	12	3	3	12	6	24	7
C	3	4	3	1	2	1	20	1	3	6	3	1	1	4	4	2	2	13	1	5
G	2	4	9	2	13	4	0	1	11	0	1	3	1	9	1	14	4	4	0	11
T	8	13	5	19	10	6	2	2	8	12	20	19	23	1	18	7	8	3	1	3

Consensus   
;	consensus.strict             	atgtgaCAgtttTgtgacAg
;	consensus.strict.rc          	CTGTCACAAAACTGTCACAT
;	consensus.IUPAC              	wtrtkaCAkhttTrtgwcAg
;	consensus.IUPAC.rc           	CTGWCAYAAADMTGTMAYAW
;	consensus.regexp             	[at]t[ag]t[gt]aCA[gt][act]ttT[ag]tg[at]cAg
;	consensus.regexp.rc          	CTG[AT]CA[CT]AAA[AGT][AC]TGT[AC]A[CT]A[AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [IPI] Inferred from physical interaction

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [HIBSCS] Human inference based on similarity to consensus sequences

 [BCE] Binding of cellular extracts

 [SM] Site mutation

 [IMP] Inferred from mutant phenotype



Reference(s)    

 [1] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56

 [2] Marzan LW., Hasan CM., Shimizu K., 2013, Effect of acidic condition on the metabolic regulation of Escherichia coli and its phoB mutant., Arch Microbiol 195(3):161-71

 [3] Baek JH., Lee SY., 2006, Novel gene members in the Pho regulon of Escherichia coli., FEMS Microbiol Lett 264(1):104-9

 [4] Han JS., Park JY., Lee YS., Thony B., Hwang DS., 1999, PhoB-dependent transcriptional activation of the iciA gene during starvation for phosphate in Escherichia coli., Mol Gen Genet 262(3):448-52

 [5] Suziedeliene E., Suziedelis K., Garbenciete V., Normark S., 1999, The acid-inducible asr gene in Escherichia coli: transcriptional control by the phoBR operon., J Bacteriol 181(7):2084-93

 [6] Yang C., Huang TW., Wen SY., Chang CY., Tsai SF., Wu WF., Chang CH., 2012, Genome-wide PhoB binding and gene expression profiles reveal the hierarchical gene regulatory network of phosphate starvation in Escherichia coli., PLoS One 7(10):e47314

 [7] Murray EL., Conway T., 2005, Multiple regulators control expression of the Entner-Doudoroff aldolase (Eda) of Escherichia coli., J Bacteriol 187(3):991-1000

 [8] Makino K., Kim SK., Shinagawa H., Amemura M., Nakata A., 1991, Molecular analysis of the cryptic and functional phn operons for phosphonate use in Escherichia coli K-12., J Bacteriol 173(8):2665-12

 [9] Wanner BL., Boline JA., 1990, Mapping and molecular cloning of the phn (psiD) locus for phosphonate utilization in Escherichia coli., J Bacteriol 172(3):1186-96

 [10] Makino K., Shinagawa H., Amemura M., Nakata A., 1986, Nucleotide sequence of the phoB gene, the positive regulatory gene for the phosphate regulon of Escherichia coli K-12., J Mol Biol 190(1):37-44

 [11] Tommassen J., Koster M., Overduin P., 1987, Molecular analysis of the promoter region of the Escherichia coli K-12 phoE gene. Identification of an element, upstream from the promoter, required for efficient expression of phoE protein., J Mol Biol 198(4):633-41

 [12] Kim SK., Makino K., Amemura M., Shinagawa H., Nakata A., 1993, Molecular analysis of the phoH gene, belonging to the phosphate regulon in Escherichia coli., J Bacteriol 175(5):1316-24

 [13] Harris RM., Webb DC., Howitt SM., Cox GB., 2001, Characterization of PitA and PitB from Escherichia coli., J Bacteriol 183(17):5008-14

 [14] Kim SK., Kimura S., Shinagawa H., Nakata A., Lee KS., Wanner BL., Makino K., 2000, Dual transcriptional regulation of the Escherichia coli phosphate-starvation-inducible psiE gene of the phosphate regulon by PhoB and the cyclic AMP (cAMP)-cAMP receptor protein complex., J Bacteriol 182(19):5596-9

 [15] Kimura S., Makino K., Shinagawa H., Amemura M., Nakata A., 1989, Regulation of the phosphate regulon of Escherichia coli: characterization of the promoter of the pstS gene., Mol Gen Genet 215(3):374-80

 [16] Makino K., Shinagawa H., Amemura M., Kimura S., Nakata A., Ishihama A., 1988, Regulation of the phosphate regulon of Escherichia coli. Activation of pstS transcription by PhoB protein in vitro., J Mol Biol 203(1):85-95

 [17] Otsuka J., Watanabe H., Mori KT., 1996, Evolution of transcriptional regulation system through promiscuous coupling of regulatory proteins with operons; suggestion from protein sequence similarities in Escherichia coli., J Theor Biol 178(2):183-204

 [18] Kasahara M., Makino K., Amemura M., Nakata A., Shinagawa H., 1991, Dual regulation of the ugp operon by phosphate and carbon starvation at two interspaced promoters., J Bacteriol 173(2):549-58

 [19] Yoshida Y., Sugiyama S., Oyamada T., Yokoyama K., Kim SK., Makino K., 2011, Identification of PhoB binding sites of the yibD and ytfK promoter regions in Escherichia coli., J Microbiol 49(2):285-9

 [20] Wanner BL, 1993, Gene regulation by phosphate in enteric bacteria., J Cell Biochem, 1993 Jan

 [21] VanBogelen RA, Olson ER, Wanner BL, Neidhardt FC, 1996, Global analysis of proteins synthesized during phosphorus restriction in Escherichia coli., J Bacteriol, 1996 Aug

 [22] Smith MW, Payne JW, 1992, Expression of periplasmic binding proteins for peptide transport is subject to negative regulation by phosphate limitation in Escherichia coli., FEMS Microbiol Lett, 1992 Dec 15

 [23] Crépin S, Chekabab SM, Le Bihan G, Bertrand N, Dozois CM, Harel J, 2011, The Pho regulon and the pathogenesis of Escherichia coli., Vet Microbiol, 2011 Nov 21

 [24] Makino K, Shinagawa H, Amemura M, Kawamoto T, Yamada M, Nakata A, 1989, Signal transduction in the phosphate regulon of Escherichia coli involves phosphotransfer between PhoR and PhoB proteins., J Mol Biol, 1989 Dec 5

 [25] Gao R, Stock AM, 2013, Evolutionary tuning of protein expression levels of a positively autoregulated two-component system., PLoS Genet, 2013 Oct

 [26] Wanner BL, 1996, Signal transduction in the control of phosphate-regulated genes of Escherichia coli., Kidney Int, 1996 Apr

 [27] Wanner BL, Wilmes-Riesenberg MR, 1992, Involvement of phosphotransacetylase, acetate kinase, and acetyl phosphate synthesis in control of the phosphate regulon in Escherichia coli., J Bacteriol, 1992 Apr

 [28] Amemura M, Makino K, Shinagawa H, Nakata A, 1990, Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes phosphorylation of PhoB and PhoM-open reading frame 2., J Bacteriol, 1990 Nov

 [29] Creager-Allen RL, Silversmith RE, Bourret RB, 2013, A link between dimerization and autophosphorylation of the response regulator PhoB., J Biol Chem, 2013 Jul 26

 [30] Makino K, Amemura M, Kawamoto T, Kimura S, Shinagawa H, Nakata A, Suzuki M, 1996, DNA binding of PhoB and its interaction with RNA polymerase., J Mol Biol, 1996 May 31

 [31] Makino K, Amemura M, Kim SK, Nakata A, Shinagawa H, 1993, Role of the sigma 70 subunit of RNA polymerase in transcriptional activation by activator protein PhoB in Escherichia coli., Genes Dev, 1993 Jan

 [32] Martínez-Hackert E, Stock AM, 1997, Structural relationships in the OmpR family of winged-helix transcription factors., J Mol Biol, 1997 Jun 13

 [33] Ellison DW, McCleary WR, 2000, The unphosphorylated receiver domain of PhoB silences the activity of its output domain., J Bacteriol, 2000 Dec

 [34] Solá M, Gomis-Rüth FX, Serrano L, González A, Coll M, 1999, Three-dimensional crystal structure of the transcription factor PhoB receiver domain., J Mol Biol, 1999 Jan 15

 [35] Arribas-Bosacoma R, Kim SK, Ferrer-Orta C, Blanco AG, Pereira PJ, Gomis-Rüth FX, Wanner BL, Coll M, Solà M, 2007, The X-ray crystal structures of two constitutively active mutants of the Escherichia coli PhoB receiver domain give insights into activation., J Mol Biol, 2007 Feb 16

 [36] Martínez-Hackert E, Stock AM, 1997, The DNA-binding domain of OmpR: crystal structures of a winged helix transcription factor., Structure, 1997 Jan 15

 [37] Tung CS, McMahon BH, 2012, A structural model of the E. coli PhoB dimer in the transcription initiation complex., BMC Struct Biol, 2012 Mar 20

 [38] Gao R, Stock AM, 2015, Temporal hierarchy of gene expression mediated by transcription factor binding affinity and activation dynamics., MBio, 2015 May 26

 [39] Blanco AG, Sola M, Gomis-Rüth FX, Coll M, 2002, Tandem DNA recognition by PhoB, a two-component signal transduction transcriptional activator., Structure, 2002 May

 [40] Bachhawat P, Swapna GV, Montelione GT, Stock AM, 2005, Mechanism of activation for transcription factor PhoB suggested by different modes of dimerization in the inactive and active states., Structure, 2005 Sep

 [41] Baek JH, Lee SY, 2007, Transcriptome analysis of phosphate starvation response in Escherichia coli., J Microbiol Biotechnol, 2007 Feb

 [42] Grillo-Puertas M, Rintoul MR, Rapisarda VA, 2016, PhoB activation in non-limiting phosphate condition by the maintenance of high polyphosphate levels in the stationary phase inhibits biofilm formation in Escherichia coli., Microbiology, 2016 Jun

 [43] Gao R, Stock AM, 2017, Quantitative Kinetic Analyses of Shutting Off a Two-Component System., MBio, 2017 May 16

 [44] Gao R, Godfrey KA, Sufian MA, Stock AM, 2017, Counterbalancing Regulation in Response Memory of a Positively Autoregulated Two-Component System., J Bacteriol, 2017 Sep 15

 [45] Kou X, Liu X, Liu Y, Li C, Liu M, Jiang L, 2018, Backbone resonance assignment of the response regulator protein PhoBNF20D from Escherichia coli., Biomol NMR Assign, 2018 Apr

 [46] Kou X, Liu Y, Li C, Liu M, Jiang L, 2018, Dimerization and Conformational Exchanges of the Receiver Domain of Response Regulator PhoB from Escherichia coli., J Phys Chem B, 2018 Jun 7



RegulonDB