![]() ![]() |
Synonyms: NhaR-Na+, NhaR |
Summary:
The transcription factor NhaR, for "Na+/H+ antiporter Regulator," is dependent on Na+ and controls the transcription of genes involved in adaptation to Na+ and alkaline pH [1, 2, 3, 11, 12], response to adverse conditions [6, 7], and biofilm formation [4, 10]. This regulator belongs to the LysR family. NhaR is composed of two domains: the amino-terminal domain, which contains the DNA-binding region, and the carboxy-terminal domain, which is possibly responsible for inducer binding [5]. In systematic studies of oligomerization, it was shown that some members of the LysR family, like NhaR, interact with other members of the family to form heterodimers, but the physiological significance of this is unknown []. The binding targets for NhaR are 17 nucleotides long. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | LysR | ||||||||||||||||||
Sensing class: | External sensing using transported metabolites | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | nhaR | ||||||||||||||||||
Genome position: | 18715-19620 | ||||||||||||||||||
Length: | 906 bp / 301 aa | ||||||||||||||||||
Operon name: | nhaAR | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | nhaA, nhaR, osmC, pgaA, pgaB, pgaC, pgaD | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
biosynthesis of macromolecules (cellular constituents) (3)
pH (2)
Porters (Uni-, Sym- and Antiporters) (1)
membrane (1)
Transcription related (1)
Read more >
|
||||||
Regulated operon(s) | nhaAR, osmC, pgaABCD | ||||||
First gene in the operon(s) | nhaA, osmC, pgaA | ||||||
Simple and complex regulons | H-NS,Lrp,NhaR,RcsB H-NS,NhaR NhaR,OmpR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
NhaR-Na+ | activator | nhaAp1 | Sigma70 | -66.0 | -97.0 | nhaA, nhaR |
ttcttcaataGCTCGTAAAAAACGAATtattcctaca
|
17384 | 17400 | [BCE], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [1], [2], [3], [8], [9] | |
NhaR-Na+ | activator | nhaAp1 | Sigma70 | -44.0 | -75.0 | nhaA, nhaR |
cgaattattcCTACACTATAATCTGATtttaacgatg
|
17406 | 17422 | [BCE], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [1], [2], [3], [8], [9] | |
NhaR-Na+ | activator | nhaAp1 | Sigma70 | -34.0 | -65.0 | nhaA, nhaR |
ctacactataATCTGATTTTAACGATGattcgtgcgg
|
17416 | 17432 | [BCE], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [1], [2], [3], [9] | |
NhaR-Na+ | activator | nhaAp1 | Sigma70 | -3.0 | -34.0 | nhaA, nhaR |
gtgcggggtaAAATAGTAAAAACGATCTattcacctga
|
17447 | 17464 | [BCE], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [1], [2], [3], [8], [9] | |
NhaR-Na+ | activator | osmCp1 | Sigma70 | -42.0 | -71.0 | osmC |
gccggattttATTCGGAATATCCTGCTTatcctcgtgc
|
1556546 | 1556563 | [BCE], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [SM] | [6], [7] | |
NhaR-Na+ | activator | pgaAp | nd | -63.0 | -297.0 | pgaA, pgaB, pgaC, pgaD |
tcatcaggacTTTCGAAAAATCCGAAAtcatgcatcg
|
1092578 | 1092594 | [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [4], [10] | |
NhaR-Na+ | activator | pgaAp | nd | -41.0 | -275.0 | pgaA, pgaB, pgaC, pgaD |
cgaaatcatgCATCGGAATTTACTGATttaattattt
|
1092556 | 1092572 | [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [4], [10] |
Alignment and PSSM for NhaR TFBSs | ![]() |
---|
Aligned TFBS of NhaR |
---|
Sequence | |
---|---|
TTATTCGGAATATCCTGCTTA | |
TGCATCGGAATTTACTGATTT | |
TAGCTCGTAAAAAACGAATTA | |
TCCTACACTATAATCTGATTT | |
ACTTTCGAAAAATCCGAAATC | |
TAAAATAGTAAAAACGATCTA |
Position weight matrix (PWM). NhaR matrix-quality result |
---|
A 1 2 2 2 2 0 2 1 4 6 3 5 3 3 0 0 3 4 1 0 3 C 0 2 2 1 0 5 0 1 0 0 0 0 0 2 6 0 0 1 1 0 1 G 0 1 1 0 0 0 4 3 0 0 0 0 0 0 0 3 3 0 0 0 0 T 5 1 1 3 4 1 0 1 2 0 3 1 3 1 0 3 0 1 4 6 2 |
Consensus |
---|
; consensus.strict tccttCGgaAaaaaCggatTa ; consensus.strict.rc TAATCCGTTTTTTCCGAAGGA ; consensus.IUPAC tmmwwCRgwAwawmCkratTw ; consensus.IUPAC.rc WAATYMGKWTWTWCYGWWKKA ; consensus.regexp t[ac][ac][at][at]C[AG]g[at]A[at]a[at][ac]C[gt][ag]atT[at] ; consensus.regexp.rc [AT]AAT[CT][AC]G[GT][AT]T[AT]T[AT]C[CT]G[AT][AT][GT][GT]A |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|